Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Rat Aflatoxin B1 Aldehyde Reductase Member 3 AKR7A3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Quantification with aflatoxin B1 and B2 standards (Sigma-Aldrich A6636-5MG) was based on a six-point calibration curve in the range of 0.001-0.5 µg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: Glutathione reductase activity was measured using the Glutathione Reductase Assay kit (Millipore-Sigma, GRSA-1KT) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Glutathione reductase activity was measured using the Glutathione Reductase Assay kit (Millipore-Sigma, GRSA-1KT) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: A commercial kit (Rat RAGE/AGER ELISA, #RAB0009, Sigma-Aldrich) was used to quantify RAGE levels ...
-
bioRxiv - Cell Biology 2022Quote: ... b1-integrin (1:1000 dilution, Rat monoclonal, clone MB1.2; Millipore, #MAB1997), HSC70 (1:5000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ELISAs were used to confirm a subset of cytokines identified in the antibody arrays (CCL2, CX3CL1, and Galectin-3 rat ELISA kits, Sigma) using apical or basal supernatants from individual Transwell® inserts from the same experiment than the multiplex array.
-
bioRxiv - Systems Biology 2020Quote: ... GR: 40μL of glutathione reductase enzyme (Sigma-Aldrich; Cat#G3664; CAS: 9001-48-3) (250 units/mL ...
-
bioRxiv - Physiology 2020Quote: ... and each circulating hormones were determined using a commercially available ELISA kit for total ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-91K, Millipore), and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit ...
-
bioRxiv - Microbiology 2021Quote: ... and aflatoxin-inducing medium yeast extract agar (YES) (Sigma Aldrich, USA) plates and incubated for 5 days at 25 °C prior to ribonucleic acid (RNA ...
-
bioRxiv - Physiology 2021Quote: ... Plasma FGF21 was assayed using the rat/mouse FGF21 ELISA kit (Sigma) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-90K, Millipore). All procedures were performed by following the manufacturer’s protocol.
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Cell Biology 2019Quote: ... and rat/mouse c-peptide ELISA kit (cat # EZRMCP 2-21K, Millipore MA).
-
bioRxiv - Biochemistry 2020Quote: ... 0.16 U of glutathione reductase (Sigma-Aldrich), and 30 µM bovine insulin (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2021Quote: ... Insulin was measured by ELISA (EZRMI-13K Sigma-Aldrich - Rat/Mouse - Insulin ELISA) and the hepatic and skeletal muscle glycogen contents of fed rats (Lo et al ...
-
bioRxiv - Microbiology 2021Quote: ... Insulin was measured using the rat/mouse insulin ELISA kit from Millipore (EZRMI-13K), according to the manufacturer’s instructions (Wang et al. ...
-
bioRxiv - Developmental Biology 2022Quote: GH was measured using a mouse/rat growth hormone ELISA kit (Millipore – EZRMGH-45K), based on quantitative sandwich enzyme immunoassay technique ...
-
bioRxiv - Physiology 2020Quote: Insulin concentrations were measured by ELISA (EZRMI-13K Rat/Mouse insulin ELISA, Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Culture extracts (5 μl sample per lane) and known quantities of aflatoxin standards (Sigma) were spotted on Partisils LHPKD silica gel TLC plates (60Å ...
-
bioRxiv - Biochemistry 2023Quote: ... and aldehyde concertation was determined using Protein Carbonyl Content Assay Kit (Sigma-Aldrich). Aldehyde concentration was determined to be 4 mol aldehyde per mol protein ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and insulin levels were estimated using a total rat insulin ELISA kit (Merck Millipore, UK) according to the manufacturer’s instructions ...
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: Plasma FGF21 and insulin were assayed using the rat/mouse FGF21 ELISA kit (EMD Millipore) and the ultrasensitive mouse insulin ELISA kit (Crystal Chem) ...
-
bioRxiv - Neuroscience 2021Quote: ... HMG-CoA Reductase (Merck-Millipore, ABS229, 1:700), LRP1 (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... and exposed to decyl aldehyde (Sigma A0398589) fumes ...
-
bioRxiv - Microbiology 2022Quote: ... Both aldehydes were purchased from Sigma-Aldrich, Inc.
-
bioRxiv - Microbiology 2023Quote: ... Both aldehydes were purchased from Sigma-Aldrich, Inc.
-
bioRxiv - Immunology 2022Quote: Serum insulin was determined using a rat/mouse insulin ELISA kit (Millipore, Billerica, Merck KGaA, USA) as instructed ...
-
bioRxiv - Genetics 2021Quote: ... Mouse plasma insulin and leptin levels were determined by using Rat/ Mouse Insulin ELISA Kit (Millipore, EZRMI-13K for insulin and EZML-82K for leptin ...
-
bioRxiv - Physiology 2020Quote: ... Insulin release from islets was measured as described with Rat/Mouse Insulin ELISA kit (Millipore Sigma) (26).
-
bioRxiv - Plant Biology 2020Quote: ... 0.15 mM NADPH and 5U glutathione reductase (Sigma, G3664)] using 50 g of protein extract ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were exposed to decyl aldehyde (Sigma-Aldrich) fumes for one minute and counts per second (CPS ...
-
bioRxiv - Plant Biology 2023Quote: ... individual microbiota members were cultured individually on individual R2A (Sigma) plates before being pooled together in equal ratios (OD600 ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... Insulin serum was measured using ELISA (Rat/Mouse Insulin ELISA, #EZRMI-13K, Millipore St. Charles, MO, USA)) ...
-
bioRxiv - Cell Biology 2020Quote: ... In order to inhibit HMG-CoA reductase atorvastatin (Sigma-Aldrich) was applied at final concentrations of 1 nM-10 μM for 72 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and Hydroxyurea at 2 mM (ribonucleotide reductase inhibitor; Sigma Aldrich).
-
bioRxiv - Biochemistry 2023Quote: ... Cells were incubated with the aldose reductase inhibitor Sorbinil (Sigma) at the indicated dose for 24 hours before harvesting polar metabolites.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... DHFR activity and screening of DHFR inhibitors testing was examined using the Dihydrofolate Reductase Assay Kit (Sigma). The assay is based on the ability of DHFR to catalyze the reversible nicotinamide adenine dinucleotide phosphate (NADPH ...
-
bioRxiv - Cell Biology 2019Quote: ... Aldehydes were quenched with 0.1% sodium borohydride (Sigma-Aldrich) for 7min and followed by 2-3 10min PBS washes ...
-
bioRxiv - Plant Biology 2021Quote: ... coniferyl aldehyde and abscisic acid (from Sigma-Aldrich, USA) were analyzed under the same conditions described above.
-
bioRxiv - Immunology 2022Quote: ... TNFa and CTX-I were measured using the mouse SAA-3 ELISA kit (Sigma-Aldrich), LEGEND MAX™ Mouse TNF-α ELISA Kit (BioLegend ...
-
bioRxiv - Plant Biology 2022Quote: ... and 2 U of glutathione reductase from Saccharomyces cerevisiae (Sigma-Aldrich). Glutathione-dependent reduction of DTNB was followed at 412 nm ...
-
bioRxiv - Microbiology 2023Quote: ... plated on fluorodishes were incubated in 50mM NH4Cl for 5min at room temperature (RT) to quench free aldehydes and in 1X PBS containing 3% Bovine Serum Albumin (BSA, Sigma-Aldrich) for 15min at RT to block non-specific epitopes ...
-
bioRxiv - Physiology 2024Quote: ... Plasma total ghrelin was measured by mouse/rat ELISA (EZRGRT-91K, Millipore). All samples were run in duplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... Aldehydes were quenched with 0.3 M Glycine (Sigma-Aldrich, #G8898) in TBS-T for 1h at RT ...
-
bioRxiv - Cell Biology 2020Quote: si-lamin B1 (UUCCGCCUCAGCCACUGGAAAU, Sigma)
-
bioRxiv - Cell Biology 2020Quote: ... Cyclin B1 (Millipore; 05-373), PPP1CA (Bethyl ...
-
bioRxiv - Biochemistry 2023Quote: ... or fumonisin B1 (Sigma-Aldrich). Proteins were heated from 20 °C to 95 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Fumonisin B1 (FB1, Merck Sigma) treatment was performed on 5-day old seedlings grown on normal ½ MS plates that were transferred for 16 hours into multiwall plates containing liquid ½ MS medium with 2.5 µM FB1 ...
-
bioRxiv - Microbiology 2022Quote: Aldehyde and D-lactate production in Salmonella strains were measured by the Aldehyde Assay Kit and D-Lactate Assay Kit (Sigma-Aldrich), respectively ...
-
bioRxiv - Cell Biology 2019Quote: Samples were assayed for insulin or proinsulin content using ELISA according to the instructions of the manufacturers (Rat/Mouse insulin ELISA, Millipore, #EZRMI-13K ...