Labshake search
Citations for Millipore Sigma :
1 - 50 of 2477 citations for RSV M since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Polyclonal goat anti-RSV antibody (Millipore/Chemicon ...
-
bioRxiv - Microbiology 2020Quote: ... mouse monoclonal anti-RSV F (MAB8262X, Millipore), mouse anti-CD63 (Clone H5C6 RUO ...
-
bioRxiv - Microbiology 2021Quote: ... and stained with RSV-fusion protein antibody (Millipore) for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by incubation with goat anti-RSV (Millipore) diluted in dilution buffer (Agilent Dako ...
-
bioRxiv - Immunology 2021Quote: ... the reagents used were goat anti-RSV primary antibody (Millipore) and donkey anti-goat HRP-conjugated secondary antibody (Jackson ImmunoResearch) ...
-
bioRxiv - Cell Biology 2020Quote: ... and RSV F protein (1:500 dilution, 488 conjugated; Millipore). Cultures were mounted using DAPI mounting medium (Vectashield ...
-
bioRxiv - Microbiology 2020Quote: ... and then with FITC-conjugated mouse anti-RSV N (Millipore) for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... and 0.25 mL of primary goat anti-RSV polyclonal antibodies (Millipore) diluted 1 to 500 in Blotto was added to RSV-infected cells ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated per one hour with anti-RSV polyclonal antibody (EMD Millipore) diluted 1:500 in dilution buffer [5% Non-fat dry milk (AmericanBio ...
-
bioRxiv - Molecular Biology 2023Quote: ... For IH the following antibodies were used: goat anti-RSV (AB1128; Millipore), goat-HRP (ab6741 ...
-
bioRxiv - Microbiology 2020Quote: ... cells were permeabilized and incubated with FITC-labeled mouse anti-RSV Nucleoprotein (Millipore), followed by washes with PBS containing 1% BSA ...
-
bioRxiv - Microbiology 2020Quote: The antibodies used were FITC-conjugated mouse monoclonal anti-RSV N (MAB 858 3F, Millipore), mouse monoclonal anti-RSV F (MAB8262X ...
-
bioRxiv - Biophysics 2023Quote: Oxotremorine-M (OXO-M) (Sigma-Aldrich) was dissolved in distilled water to make a 50 mM stock solution and further diluted in the bath solution for the final concentration 50 µM ...
-
bioRxiv - Immunology 2023Quote: ... Mice were sacrificed at day 7 (X31) and day 4 (RSV) post infection (p.i.) and lung lobes were stored in RNA-later (Sigma). Lung tissue was homogenized using a TissueLyser LT (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.8 M Betaine solution (5 M, Sigma, USA), 2 mM MgSO4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Fixed myotubes were blocked and permeabilized in 3% (m/m)-BSA solution with 0.1% (m/m) Digitonin (D5628, Sigma-Aldrich, Germany) in DPBS (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... and RSV-Rev) and a SERPINE1 shRNA construct encoded in a PLKO.1 vector (henceforth called shPAI1: TRCN0000370159, sense: ACACCCTCAGCATGTTCATTG; Sigma-Aldrich). A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864 ...
-
bioRxiv - Microbiology 2019Quote: ... in 0.1 M phosphate buffer to block non-specific binding then incubated with the primary antibodies: mouse anti-RSV fusion protein monoclonal antibody (MAB8599, Millipore, USA) or goat anti-human IgG (Licor ...
-
bioRxiv - Immunology 2021Quote: ... The blots were stripped with Restore Western Blot Stripping Buffer (Thermo-Fisher) and reprobed with goat anti-RSV polyclonal antisera (Sigma-Aldrich) and a monoclonal antibody specific for GAPDH (6C5 ...
-
bioRxiv - Microbiology 2023Quote: ... Conversion to the postfusion state was also evaluated for the RSV F variant R-1b using the postfusion-specific antibody 131-2A37 (Millipore Sigma) and the postfusion RSV A2 F52 as positive control.
-
bioRxiv - Genomics 2020Quote: ... and 4.5 × 10−4 M monothioglycerol (Sigma M-6145). After 48 hr in culture ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6 mL of 25% m/m potassium hydroxide (Sigma, USA) in methanol (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... CK-M (Sigma), α-actinin (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.13 M citric acid [Golden Bell], 0.08 M sodium citrate [Golden Bell] buffer [pH 4], 0.15 M hydroquinone [Sigma-Aldrich], 0.005 M silver nitrate [JT Baker]) for 90 min in the dark at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... GABABR agonists: GABA (10−3 M, 10−4 M, Sigma-Aldrich), baclofen (10−4 M ...
-
bioRxiv - Cell Biology 2020Quote: ... Oxotremorine M (Oxo-M) and LY294002 were purchased from Sigma-Aldrich. CCG-4986 was purchased from ChemBridge (San Diego ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or potassium hydroxide (KOH, 1 M or 5 M, Sigma-Aldrich) solutions using a bench-top pH meter (pH 210 ...
-
bioRxiv - Bioengineering 2019Quote: Cyclic voltammetry and electrochemical impedance spectroscopy were measured in 0.01 M phosphate buffered saline (PBS) (NaCl 0.138 M; KCl - 0.0027 M; pH 7.4; Sigma, St. Louis, MO) using a three electrode cell consisting of a previously described Injectrode working electrode ...
-
bioRxiv - Genomics 2022Quote: ... The blot was washed twice with 2X SSPE buffer (20X SSPE Buffer: 0.02 M EDTA and 2.98 M NaCl in 0.2 M phosphate buffer pH 7.4; Sigma-Aldrich CAT. S2015) for 5 min at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... filtered through a 0.22 µm syringe filter and neutralized with 10X phosphate buffered saline (PBS, 0.01 M phosphate buffer, 0.0027 M KCl and 0.137 M NaCl, Millipore Sigma P4417-100TAB), pH 7.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were neutralized with 10X phosphate buffered saline (PBS, 0.01 M phosphate buffer, 0.0027 M KCl and 0.137 M NaCl, Millipore Sigma P4417-100TAB), pH 7.4 to a final concentration of 2.5x PBS (342.5 mM NaCl ...
-
bioRxiv - Immunology 2022Quote: ... + 35 mL substrate buffer (0.1 M citric acid, 0.1 M Tris (Sigma)) supplemented with 21 μl H2O2 (Sigma)) ...
-
bioRxiv - Microbiology 2019Quote: ... each containing 15 ml of M&M media (Sigma Aldrich, NSW, Australia) having 10% FBS ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2 M acrylamide (Sigma), 90 ppm N,N’-methylenebisacrylamide (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 8 M Urea (Sigma) and 1% Chaps (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... m-3M3FBS (Sigma Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... 6.25μ M (T9033, Sigma); Bisindolylmaleimide I (GF109203X) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 M HEPES (Sigma), 2 mM L-glutamine (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... 8 M Urea (Sigma) and 1% Chaps (Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1 M Dithiothreitol (Sigma) and quantified using a BioRad DC assay as per the manufacturers protocol ...
-
bioRxiv - Immunology 2019Quote: ... 3 M NaAc (Sigma) and 1 µl GeneElute (Sigma ...
-
bioRxiv - Physiology 2020Quote: ... 0.1 M sucrose (Sigma) and 3 mg/mL bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.2 M sorbitol (Sigma), 1 mM MgCl2 (VWR) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 M thiourea (Sigma), and β-mercaptoethanol for 30 min at room temperature prior to analysis ...
-
bioRxiv - Genomics 2021Quote: ... 0.1 M cysteamine (Sigma), 0.8 mg/mL glucose oxidase (Sigma) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 M Urea (Sigma) and 1% Chaps (Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.2 M imidazole (Sigma), 10 mM NaF (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 M thiourea (Sigma) and 30 mM Trizma base (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... methionine (Sigma M-9625), or isotopically labeled D3-methyl-methionine (Cambridge Isotope Laboratories DLM- 431-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.1 M Tris (Sigma), and 0.3% (v/v ...