Labshake search
Citations for Millipore Sigma :
1 - 50 of 418 citations for RBP5 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: All siRNA sequences used were either a commercial predesigned siRNA from Sigma-Aldrich (MISSION siRNA) or were previously validated by other published studies (see Table S2) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used the three individual siRNAs (Mission siRNA, Sigma). The validation step was repeated three times and we scored for phenotypic concordance ...
-
bioRxiv - Molecular Biology 2021Quote: ... The luciferase siRNA and MCM siRNA were synthesized by Sigma 54 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA oligonucleotides (Sigma) were ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: siRNA oligonucleotides (Sigma) were transfected into cells using Lipofectamine RNAiMax (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... specific siRNAs (Sigma) were introduced into the cells using Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... siRNAs (Sigma-Aldrich) dissolved in nuclease-free water were transfected using Lipofectamine RNAiMAX reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: All siRNAs (Sigma) were used at 20 nM and transfected with Lipofectamine RNAiMAX reagent (Thermo ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNAs (Sigma-Aldrich) used were ...
-
bioRxiv - Cancer Biology 2023Quote: ... predesigned siRNA (Sigma) targeting PLK1 were transfected with jetPRIME Versatile DNA/siRNA transfection reagent (Polyplus ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control siRNA and siRNAs for ZNF704 were synthesized by Sigma-Aldrich. The siRNA oligonucleotides were transfected into cells using RNAiMAX with a final concentration of 20 nM.
-
bioRxiv - Cancer Biology 2020Quote: ... or scrambled control siRNA (siCTR) (siRNA universal negative control, Sigma-Aldrich) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... following the manufacturer’s protocol with siRNA targeting STK25 (On-TargetPlus siRNA, Horizon Discovery, L-004873-00-0050) or siRNA targeting PRKAR1A (EHU071341, Sigma) for protein knockdown or non-targeting control siRNA (ON-TARGETplus non-targeting pool ...
-
bioRxiv - Molecular Biology 2023Quote: Chondrocytes were transiently transfected with siRNA targeting Tnxb (GenePharma) or negative□control siRNA (scrambled; GenePharma) using X□tremeGENE siRNA transfection reagent (Sigma) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... or negative control siRNA (MISSION® siRNA Universal Negative Control #1, Sigma), respectively ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... MYC siRNA (SASI_Hs01_00222676) and MZF1 siRNA (SASI_Hs01_00096728) were purchased from Sigma-Aldrich. MISSION siRNA Universal Negative Controls (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA transfection was performed in cells plated overnight using scrambled siRNA (Sigma) or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNA sequences (5’ – 3’) are the following: Universal siRNA control (Sigma, SIC001)
-
bioRxiv - Genomics 2023Quote: Universal negative control siRNA (Mission siRNA Universal Negative Control #1, SIC001, Sigma) and ILF3 siRNA1 and ILF3siRNA2 (ILF3_1 PDSIRNA2D ...
-
bioRxiv - Genetics 2023Quote: ... or a negative control siRNA (siRNA Universal Negative Control #1, Sigma-Aldrich), using Lipofectamine RNAiMax (Invitrogen) ...
-
Bilateral regulation of EGFR activity and local PI dynamics observed with superresolution microscopybioRxiv - Cell Biology 2024Quote: ... or EGFR–Halo and PLCG1 siRNA (MISSION® siRNA, SASI_Hs02_00334210, Sigma-Aldrich) with Neon Transfection System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides (53nM, Sigma) were transfected using oligofectamine (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... transfection of siRNA (Sigma, pool of two siRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50 µM siRNA (Sigma) was reverse transfected into cells for 48 hrs using RNAiMax (Thermo Fisher #13778030) ...
-
bioRxiv - Bioengineering 2022Quote: ... Negative siRNA control (MISSION siRNA Universal negative control) was purchased from Sigma-Aldrich. COS-7 cells were plated in both glass-bottom Petri dishes (for imaging ...
-
bioRxiv - Neuroscience 2019Quote: ... or scrambled-siRNA-Cy3 (Mission®siRNA universal negative controls, ProducNo. SIC003, Sigma) alone were applied on the surface of the SN (2 µg of the target siRNA or scrambled-siRNA mixed with i-Fect™ (Neuromics ...
-
bioRxiv - Cell Biology 2020Quote: ... Negative siRNA control (MISSION siRNA Universal negative control) was purchased from Sigma-Aldrich. COS-7 cells were plated in both glass-bottom petri dishes (for imaging ...
-
bioRxiv - Cancer Biology 2022Quote: E2F7 and BRCA2 siRNAs and negative control siRNA were purchased from Sigma-Aldrich. Cells were seeded onto 6-well or 96-well plates for 24 hours and followed by siRNA (10 nM ...
-
bioRxiv - Cell Biology 2019Quote: Non-silencing siRNA duplexes (MISSION® siRNA Universal Negative Control #1, SIC-001) and custom designed siRNA duplexes were purchased from Sigma-Aldrich, and transfected into subconfluent cells using HiPerfect transfection (QIAGEN ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of siRNAs (mission siRNAs purchased from Sigma-Aldrich, St. Louis, MO, USA) used against NumbL is ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA-induced depletion of vimentin was obtained with 20 nM of siRNAs from Sigma, #1 5’-GUCUUGACCUUGAACGCAAdTdT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: Custom CHMP4B siRNA oligonucleotides (Dharmacon, AUCGAUAAAGUUGAUGAGUUAUU) and custom CEP55 siRNA oligonucleotides (Millipore Sigma, AGGCAUGUACUUUAGACUU) were transfected into HeLa cells using Liptofectamine RNAiMAX with 40nM oligonucleotide ...
-
bioRxiv - Cell Biology 2023Quote: ... The control siRNA and the siRNAs for knocking down hydrolases were purchased from Sigma as follows:
-
bioRxiv - Neuroscience 2020Quote: ... and Sox9 siRNA (SASI_Rn02_00372739, Sigma) or negative control siRNA (SIC001-5X1NMOL ...
-
bioRxiv - Cancer Biology 2020Quote: Control siRNA (SIC001, Sigma-Aldrich) was used as a negative control ...
-
bioRxiv - Systems Biology 2019Quote: The siRNAs (synthesized by Sigma) are shown below:
-
bioRxiv - Cell Biology 2021Quote: ... siRNA against VPS35 from Sigma Silencer Select with a targeting sequence 5’-CCATGGATTTTGTACTGCTTT-3’ and Integrated DNA Technologies with a targeting sequence 5’-GAGATATTCAATAAGCTCAACCTTG-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Piezo1 and scramble siRNA (Sigma) transfections were done on the next day using lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... KCNB2 siRNA (Sigma-Aldrich HS0200338274), control siRNA-A (Santa Cruz Biotechnology sc-37007 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SCN3A siRNA (Sigma-Aldrich HS0200316523), KCNB2 siRNA (Sigma-Aldrich HS0200338274) ...
-
bioRxiv - Cell Biology 2020Quote: siRNAs were purchased from Sigma. Sequences of siRNAs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and control siRNA (Sigma, SIC001) were transfected at a final concentration of 30 nM using Lipofectamine RNAiMAX reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: siRNAs were purchased from SIGMA targeting RBFOX2 (on-TARGET siRNA pool ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNAs were purchased from Sigma. Mission siRNA universal negative control (SIC001 ...
-
bioRxiv - Immunology 2020Quote: ... siRNA mPolg2 (NM_015810 Sigma-Aldrich), siMfn1 (NM_024200 Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNAs were purchased from Sigma. Mission siRNA universal negative control (SIC001 ...
-
bioRxiv - Microbiology 2022Quote: ... siRNAs purchased from Sigma-Aldrich are as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... NR0B2 siRNA was from Sigma. Expression of the target genes after the knockdown was assessed using qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... siRNA RAB27A (MISSION EHU091501, Sigma) targets human RAB27A ...
-
bioRxiv - Microbiology 2024Quote: siRNAs were synthesized by Sigma with the following designed sequences: