Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Mouse Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... mouse FGF21 ELISA kit (Sigma-Aldrich, EZRMFGF21-26K).
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse IL-6 ELISA kit (Sigma, RAB0309), anti-mouse G-CSF ELISA kit (MCS00 ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Serum insulin levels were determined by ELISA using mouse insulin ELISA kit from Sigma according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... mouse GLP-1 ELISA kit (EZGLP1T) from Sigma-Aldrich; mouse GDF15 ELISA kit (DY6385 ...
-
bioRxiv - Physiology 2020Quote: ... and each circulating hormones were determined using a commercially available ELISA kit for total ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-91K, Millipore), and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit ...
-
bioRxiv - Physiology 2022Quote: siRNA Universal Negative Control (SIC001) and si-PCMT1 (SASI_Hs01_00229688) were from Sigma-Aldrich and transfected using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... pLKO-PCMT1 construct (TRCN0000036403) and Non-Target shRNA Control (SHC016) were from Sigma-Aldrich. Lentiviral pLKO constructs were transfected with packaging and envelope plasmids to HEK293T cells ...
-
bioRxiv - Physiology 2021Quote: ... Plasma FGF21 was assayed using the rat/mouse FGF21 ELISA kit (Sigma) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-90K, Millipore). All procedures were performed by following the manufacturer’s protocol.
-
bioRxiv - Genetics 2021Quote: ... Mouse plasma insulin and leptin levels were determined by using Rat/ Mouse Insulin ELISA Kit (Millipore, EZRMI-13K for insulin and EZML-82K for leptin ...
-
bioRxiv - Cell Biology 2019Quote: ... and rat/mouse c-peptide ELISA kit (cat # EZRMCP 2-21K, Millipore MA).
-
bioRxiv - Cell Biology 2019Quote: ... The CRP concentration in mouse serum was measured using the mouse CRP ELISA kit (Sigma-Aldrich, RAB1121) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Microbiology 2021Quote: ... Insulin was measured using the rat/mouse insulin ELISA kit from Millipore (EZRMI-13K), according to the manufacturer’s instructions (Wang et al. ...
-
bioRxiv - Developmental Biology 2022Quote: GH was measured using a mouse/rat growth hormone ELISA kit (Millipore – EZRMGH-45K), based on quantitative sandwich enzyme immunoassay technique ...
-
bioRxiv - Physiology 2021Quote: ... Insulin was measured by ELISA (EZRMI-13K Sigma-Aldrich - Rat/Mouse - Insulin ELISA) and the hepatic and skeletal muscle glycogen contents of fed rats (Lo et al ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies used for protein quantification for ELISAs were mouse monoclonal anti-His (His-Tag mAb, EMD-Millipore), and biotinylated mouse anti-rat Cd4 (clone OX68) ...
-
bioRxiv - Physiology 2020Quote: Insulin concentrations were measured by ELISA (EZRMI-13K Rat/Mouse insulin ELISA, Merck Millipore) according to the manufacturer’s instructions ...
-
ARID1a protects against steatosis and insulin resistance via PPARalpha-mediated fatty acid oxidationbioRxiv - Cell Biology 2019Quote: ... Insulin plasma levels were determined using mouse insulin ELISA kit (Millipore, St. Charles, MO, US). The levels of the serum inflammatory indicators were measured by ELISA (BD Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... TNFa and CTX-I were measured using the mouse SAA-3 ELISA kit (Sigma-Aldrich), LEGEND MAX™ Mouse TNF-α ELISA Kit (BioLegend ...
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: Plasma FGF21 and insulin were assayed using the rat/mouse FGF21 ELISA kit (EMD Millipore) and the ultrasensitive mouse insulin ELISA kit (Crystal Chem) ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: The amount of Shh secreted by mouse pancreatic tumor cells was quantified by using the Mouse Shh-N ELISA Kit (#RAB0431, Millipore), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Serum IL-6 levels were quantified using a commercial mouse IL-6 ELISA kit (RAB0308, Sigma) according to the manufacturer’s instructions and analyzed using spectra-iMAX (Molecular Devices).
-
bioRxiv - Immunology 2022Quote: Serum insulin was determined using a rat/mouse insulin ELISA kit (Millipore, Billerica, Merck KGaA, USA) as instructed ...
-
bioRxiv - Microbiology 2021Quote: ... the antibodies isotypes were determined by ELISA using a mouse Ig isotyping kit (ISO-2, SIGMA).
-
bioRxiv - Physiology 2020Quote: ... Insulin release from islets was measured as described with Rat/Mouse Insulin ELISA kit (Millipore Sigma) (26).
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... Insulin serum was measured using ELISA (Rat/Mouse Insulin ELISA, #EZRMI-13K, Millipore St. Charles, MO, USA)) ...
-
bioRxiv - Immunology 2024Quote: ... 96-well ELISA plates were first coated overnight with poly-L-lysine (Sigma), then overnight with DNA from calf thymus (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... were detected by ELISA Kits (from Millipore) within 24h according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... STAR EGFR ELISA Kit (Millipore, Billerica, MA) and followed by manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... Cardiac Muscle ELISA Kit (RAB0634, Sigma-Aldrich), and 100 uL of cell culture supernatant after 24 hours of treatment with each drug at 0.5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... C-reactive protein (CRP) was measured by an ELISA kit (cat. number CYT294, Millipore Sigma, Saint Louis, MO) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... or cell culture supernatants were quantified by ELISA methods (Activin A ELISA kit, Sigma, St ...
-
bioRxiv - Cell Biology 2023Quote: Enzyme-linked immunosorbent assay (ELISA) kits were used to measure the levels of mouse HGF (Sigma-Aldrich, RAB0214), mouse EGF (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: Plasma leptin levels were determined using a commercially available mouse leptin ELISA kit (EMD Millipore, St. Charles, MO, USA). The intra-assay variation of the kit was between 1.06-1.76% ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 25 μg/l recombinant mouse (Sigma-Aldrich) or human epithelial growth factor (EGF ...
-
bioRxiv - Bioengineering 2020Quote: ... human VEGF ELISA kit (RAB0507-1KT, Sigma Aldrich), glutaraldehyde solution (340855 ...
-
bioRxiv - Cell Biology 2021Quote: ... ALP activity was determined by ELISA kit (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... Mouse insulin and C-peptide were detected by multiplex ELISA (Millipore) kit in the plasma samples collected during the oral glucose challenge ...
-
bioRxiv - Genetics 2020Quote: ... Adiponectin ELISA (mouse Adiponectin, EZMADP-60K, EMD Millipore Corporation, Darmsbalt, Germany) and Cholesterol Assay (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: Protein-protein interactions were analyzed using Duolink in situ orange starter fluorescence kit (mouse/rabbit, Sigma-Aldrich) in human osteosarcoma U2OS cells (WT ...
-
bioRxiv - Biochemistry 2022Quote: Protein—protein interactions were studied using a Duolink In Situ Orange Starter Kit Mouse/Rabbit (Sigma, DUO92102) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Protein-protein interactions were studied using a Duolink In Situ Orange Starter Kit Mouse/Rabbit (Sigma DUO92102) following the manufacturer’s protocol ...
-
bioRxiv - Pathology 2023Quote: ... adiponectin levels were measured by enzyme-linked immunosorbent assays (Human Chemerin ELISA kit, Biovendor, Brno, Czech Republic; Human Resistin ELISA kit, Millipore Sigma; Human Total Adiponectin/Acrp30 Quantikine ELISA Kit ...
-
bioRxiv - Cell Biology 2019Quote: Samples were assayed for insulin or proinsulin content using ELISA according to the instructions of the manufacturers (Rat/Mouse insulin ELISA, Millipore, #EZRMI-13K ...
-
bioRxiv - Cell Biology 2019Quote: Samples were assayed for insulin or proinsulin content using ELISA according to the instructions of the manufacturers (Rat/Mouse insulin ELISA, Millipore, #EZRMI-13K ...
-
bioRxiv - Physiology 2024Quote: ... Serum samples were stored at −80 °C until assessed by ELISA according to manufacturer’s instructions (Ultrasensitive Human Growth Hormone ELISA, 22-HGHHUU-E01, ALPCO; mGH, EZRMGH-45K and Rat/Mouse Insulin ELISA, EZRMI-13K, Millipore).
-
bioRxiv - Immunology 2023Quote: ... Antibody binding to N protein was detected using conventional two-step ELISA with an HRPO-conjugated anti-mouse or anti-rat Fc antibody (Sigma Aldrich cat # A9309). All assays included a standard curve of mouse neutralising S1 antibody and mouse anti-N antibody (Sino Biological) ...