Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Mouse LIM Domain Kinase 2 LIMK2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... siRNA targeting the LIM domain of EPLIN (# SASI_Hs02_00326071; TATTGTAAGCCTCACTTCAA) and a scrambled control siRNA (#SIC001) were obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2020Quote: ... Purified proteins were diluted to a final concentration of 50 mM NaCl and then concentrated on Amicon centrifugal filters 30K for FHL and 10K for LIM domains (Millipore). The proteins’ purities and identities were confirmed by SDS-PAGE and mass spectrometry ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (R)-(+)-Limonene (lim, Sigma-Aldrich #183164), polygodial (polyg ...
-
bioRxiv - Cell Biology 2019Quote: ... and rat/mouse c-peptide ELISA kit (cat # EZRMCP 2-21K, Millipore MA).
-
bioRxiv - Biochemistry 2019Quote: ... The kinase domains were expressed in Escherichia coli ROSETTA (DE3) cells (Novagen) with TEV cleavable N-terminal GST and a non-cleavable C-terminal His6-tag ...
-
bioRxiv - Cancer Biology 2024Quote: mTOR kinase domain protein was purchased from Sigma-Aldrich (Cat # 14-770). ETV7 protein (Cat # TP307742 ...
-
bioRxiv - Cancer Biology 2024Quote: CAMK2A D135N kinase domain was recombinantly expressed in BL21(DE3) cells (Millipore) as previously described32 ...
-
bioRxiv - Physiology 2021Quote: ... mouse FGF21 ELISA kit (Sigma-Aldrich, EZRMFGF21-26K).
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse IL-6 ELISA kit (Sigma, RAB0309), anti-mouse G-CSF ELISA kit (MCS00 ...
-
bioRxiv - Microbiology 2021Quote: ... the antibodies isotypes were determined by ELISA using a mouse Ig isotyping kit (ISO-2, SIGMA).
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-activated MAP kinase (diphosphorylated ERK-1&2, 1:20; Sigma-Aldrich), and rabbit anti-Sty (1:50 ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Serum insulin levels were determined by ELISA using mouse insulin ELISA kit from Sigma according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... mouse GLP-1 ELISA kit (EZGLP1T) from Sigma-Aldrich; mouse GDF15 ELISA kit (DY6385 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The plasmid that contains the kinase domain of human HASPIN was transformed into Escherichia coli strain Rosetta™ 2(DE3) pLysS (Novagen, Madison, WI, USA). The transformed cells were grown at 37□ until OD600 reached 0.8 ...
-
bioRxiv - Microbiology 2020Quote: ... 2 U Pyruvate kinase (Sigma Aldrich), 2 U Lactate dehydrogenase (Roche ...
-
bioRxiv - Physiology 2020Quote: ... and each circulating hormones were determined using a commercially available ELISA kit for total ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-91K, Millipore), and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit ...
-
bioRxiv - Physiology 2021Quote: ... Plasma FGF21 was assayed using the rat/mouse FGF21 ELISA kit (Sigma) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-90K, Millipore). All procedures were performed by following the manufacturer’s protocol.
-
bioRxiv - Genetics 2021Quote: ... Mouse plasma insulin and leptin levels were determined by using Rat/ Mouse Insulin ELISA Kit (Millipore, EZRMI-13K for insulin and EZML-82K for leptin ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the activity of Rac1 and Cdc42 were assessed by affinity purification using magnetic beads coupled to the p21-binding domain of p21-activated protein kinase (PAK) (Millipore) that specifically binds the active (GTP-bound ...
-
bioRxiv - Cell Biology 2019Quote: ... The CRP concentration in mouse serum was measured using the mouse CRP ELISA kit (Sigma-Aldrich, RAB1121) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... Pyruvate kinase activity kit (MAK072, Sigma-Aldrich) was used according to the manufacturer’s protocol to evaluate pyruvate kinase activity ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The kinase domain of human HASPIN (residue 452 – 798) was cloned into the expression vector pET-21a(+) (Novagen, Madison, WI, USA). The genomic DNA of HASPIN was provided from the Korea Human Gene Bank ...
-
bioRxiv - Biochemistry 2023Quote: ... Full-length BTK and BTK linker kinase domain (WT and mutants) were produced by co-expressing with YopH in BL21(DE3) (Millipore Sigma) or BL21-Gold(DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... Insulin was measured using the rat/mouse insulin ELISA kit from Millipore (EZRMI-13K), according to the manufacturer’s instructions (Wang et al. ...
-
bioRxiv - Developmental Biology 2022Quote: GH was measured using a mouse/rat growth hormone ELISA kit (Millipore – EZRMGH-45K), based on quantitative sandwich enzyme immunoassay technique ...
-
bioRxiv - Physiology 2021Quote: ... Insulin was measured by ELISA (EZRMI-13K Sigma-Aldrich - Rat/Mouse - Insulin ELISA) and the hepatic and skeletal muscle glycogen contents of fed rats (Lo et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM ATP and 80 U/ml Pyruvate kinase (Sigma). 1 nM of the D-loop substrate (in molecules ...
-
bioRxiv - Genetics 2020Quote: ... 2 units of pyruvate kinase/lactate dehydrogenase mixture (Millipore Sigma), and varying concentrations of AK2 (0-40 nM) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μM M3814 (DNA-dependent protein kinase inhibitor) (Sigma-Aldrich) was added to the cell media for 72 hr to repress non-homologous end joining DNA repair (Riesenberg et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... and creatine kinase (CK) levels were assessed using the Lactate Dehydrogenase Activity Assay Kit and Creatine Kinase Activity Assay Kit (Sigma), respectively ...
-
bioRxiv - Physiology 2020Quote: Insulin concentrations were measured by ELISA (EZRMI-13K Rat/Mouse insulin ELISA, Merck Millipore) according to the manufacturer’s instructions ...
-
ARID1a protects against steatosis and insulin resistance via PPARalpha-mediated fatty acid oxidationbioRxiv - Cell Biology 2019Quote: ... Insulin plasma levels were determined using mouse insulin ELISA kit (Millipore, St. Charles, MO, US). The levels of the serum inflammatory indicators were measured by ELISA (BD Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... TNFa and CTX-I were measured using the mouse SAA-3 ELISA kit (Sigma-Aldrich), LEGEND MAX™ Mouse TNF-α ELISA Kit (BioLegend ...
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: Plasma FGF21 and insulin were assayed using the rat/mouse FGF21 ELISA kit (EMD Millipore) and the ultrasensitive mouse insulin ELISA kit (Crystal Chem) ...
-
bioRxiv - Immunology 2022Quote: ... Release of IL-2 into supernatant was measured using a commercial ELISA kit (Sigma-Aldrich).
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: The amount of Shh secreted by mouse pancreatic tumor cells was quantified by using the Mouse Shh-N ELISA Kit (#RAB0431, Millipore), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S1 domain (ACRO biosystems – S1N-C52H3) or BSA (Sigma – A7906) overnight at 4°C in 50 μl/well ...
-
bioRxiv - Cell Biology 2022Quote: Serum IL-6 levels were quantified using a commercial mouse IL-6 ELISA kit (RAB0308, Sigma) according to the manufacturer’s instructions and analyzed using spectra-iMAX (Molecular Devices).
-
bioRxiv - Immunology 2022Quote: Serum insulin was determined using a rat/mouse insulin ELISA kit (Millipore, Billerica, Merck KGaA, USA) as instructed ...
-
bioRxiv - Physiology 2020Quote: ... Insulin release from islets was measured as described with Rat/Mouse Insulin ELISA kit (Millipore Sigma) (26).
-
bioRxiv - Plant Biology 2019Quote: ... for the HMA domains in pGBKT7 and anti-GAL4 activation domain (Sigma) antibodies for the AVR-Pik effectors in pGADT7.
-
bioRxiv - Plant Biology 2020Quote: ... for the HMA domains in pGBKT7 and anti-GAL4 activation domain (Sigma) antibodies for the AVR-Pik effectors in pGADT7.
-
bioRxiv - Cell Biology 2021Quote: In vitro PI3 Kinase activity measurements were performed with the PI3K Kinase Activity/Inhibitor assay kit following manufacturer’s instructions (Merck Millipore). Briefly ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... Insulin serum was measured using ELISA (Rat/Mouse Insulin ELISA, #EZRMI-13K, Millipore St. Charles, MO, USA)) ...
-
bioRxiv - Cell Biology 2019Quote: ... The activity of creatine kinase (CK) and lactate dehydrogenase (LDH) in plasma were measured using creatine kinase activity assay Kit (Sigma) and LDH activity assay kit (sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... AKT1/2 kinase inhibitor was purchased from Sigma-Aldrich (St. Louis, MO, USA). IGF-1 was purchased from PeproTech Inc (Rocky Hill ...
-
bioRxiv - Cell Biology 2022Quote: ... were detected by ELISA Kits (from Millipore) within 24h according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... STAR EGFR ELISA Kit (Millipore, Billerica, MA) and followed by manufacturer’s recommended protocol ...