Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... Genotyping was performed using the KAPA HotStart Mouse Genotyping Kit (Sigma, KK7352) using GFP primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genotyping was performed using the KAPA HotStart Mouse Genotyping Kit (Sigma, KK7352) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Immunology 2023Quote: ... using Mouse Kapa Genotyping kit (Merck-Millipore), primers (500 nM ...
-
bioRxiv - Developmental Biology 2023Quote: ... The genotyping process was conducted using the KAPA mouse genotyping kit (Millipore Sigma) using the following primer pairs ...
-
bioRxiv - Cell Biology 2020Quote: ... For genotyping PCR JumpStart RedTaq PCR master mix (Sigma-Aldrich) was used following the manufacturer’s protocol for cycling with an annealing temperature of 55°C and 35 cycles.
-
bioRxiv - Genomics 2020Quote: ... Primers used for genotyping PCR were synthesized by Sigma-Aldrich. Oligonucleotide sequences are given in Table 2.
-
bioRxiv - Cancer Biology 2019Quote: ... Genotyping PCR was performed from genomic DNA from tails using standard protocol of N-Extract kit (Sigma).
-
bioRxiv - Developmental Biology 2019Quote: ... Genotyping was done using REDExtract-N-Amp PCR ReadyMix (Sigma-Aldrich) and respective primers ...
-
bioRxiv - Cancer Biology 2019Quote: Genotyping to determine p53-/- mice was performed with the REDExtract-N-AMP Tissue PCR Kit (Sigma XNAT-100RXN). Ear punches were digested according to the kit protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was verified by PCR (REDTaq® ReadyMix™ # R4775, Sigma Aldrich). The primers ...
-
bioRxiv - Immunology 2020Quote: ... PCRs for genotyping of bacterial colonies after transformation were performed using the KAPA2G Fast ReadyMix kit (Sigma Aldrich, #KK5102) with custom designed primers and the following cycling conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... E11.5 embryos were dissected into ice-cold PBS and associated yolk sacs used for rapid genotyping using the Extract-N-Amp Tissue PCR kit as recommended by the manufacturer (Sigma). During genotyping ...
-
bioRxiv - Developmental Biology 2023Quote: ... or ear biopsies (3 week old pups) was used for PCR based genotyping using the REDExtract-N-Amp kit (Sigma-Aldrich) with the primers listed in STable5 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting supernatant was used for genotyping through REDTaq PCR Reaction Mix (Sigma Aldrich). Specific primer sets were applied to detect the CMV-Cre and IL-17A transgenes ...
-
bioRxiv - Genetics 2020Quote: PCR genotyping of all mouse strains was performed on genomic DNA obtained from tail biopsies digested with Proteinase K (Sigma, St. Louis, MO, USA) using primers listed in Table S1.
-
bioRxiv - Cell Biology 2022Quote: ... and extracted and amplified using the KAPA HotStartMouse Genotyping Kit (Sigma, KK7352). Genotyping primers for the WT allele were WT_FWD (5-ACTCCCAGCTCCAAGCTACA-3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The genotyping of the DNA extracted from ears of transgenic mice by Extract-N-Amp™ Tissue PCR Kit (Sigma St. Louis, MO) was performed following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Apo-Direct TUNEL assay kit (Millipore Sigma) was used following manufacturer protocol ...
-
bioRxiv - Biochemistry 2019Quote: Genotyping of founders (F0) was done using genomic PCR with the primers following primers provided by Sigma, forward 5’-CGCGATGACAGTTTCCAGTA-3’ reverse 5’-CAAACAAAAACCCACTGAGGA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... Genomic DNA for genotyping was isolated from mouse tail snips with lysis buffer containing Proteinase K (Sigma-Aldrich, P2308). qPCR was performed using GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Genetics 2023Quote: ... Our method of genotyping involved PCR amplification across mutation sites using the primers described in Table 1 (purchased from Sigma Aldrich). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by neutralization with an equal volume of 40 mM Tris-HCl (pH 5.5).93 Multiplex polymerase chain reaction (PCR)-based genotyping was performed using REDTaq® polymerase per manufacturer recommendations (Millipore Sigma). Oligonucleotides were multiplexed as follows ...
-
bioRxiv - Plant Biology 2019Quote: ... were sourced from Nottingham Arabidopsis Stock Centre and homozygous mutants where confirmed through genotyping PCR on genomic DNA using REDTaq® ReadyMix™ (Sigma) following their protocol ...
-
bioRxiv - Immunology 2021Quote: ... we extracted genomic DNA from mouse tails and performed PCR with REDExtract-N-Amp™ Tissue PCR Kit following the manufacturer’s instructions (Sigma-Aldrich) and analyzed samples on agarose gel ...
-
bioRxiv - Physiology 2020Quote: ... The mouse RT-PCR primers (Sigma-Aldrich) used are shown in Supplementary Tab ...
-
bioRxiv - Developmental Biology 2020Quote: ... and genotyping was performed with NovaTaq Hot Start Master Mix (Millipore) according to the manufacturer’s cycling parameters (Tm=55°C ...
-
bioRxiv - Physiology 2023Quote: ... we used the ApopTag Fluorescein Direct In Situ Apoptosis Detection Kit (S7160, Millipore Sigma) as previously described [22] ...
-
bioRxiv - Cell Biology 2023Quote: ... and Direct Red (Sigma, 365548). Slides were then washed in 0.5% glacial acetic acid (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse genotypes were determined by PCR using genomic DNA extracted using the REDExtract-N-Amp kit (Sigma XNAT) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... FastStart PCR Kit (Sigma-Aldrich) was used for PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... KAPA SYBR PCR kit (Sigma) was used for QPCR (Light Cycler 480 ...
-
bioRxiv - Cell Biology 2020Quote: Mouse genomic DNA was isolated from tail biopsies using a specific kit (Extract-N-Amp™ Tissue PCR Kit; Sigma-Aldrich, Darmstadt, Germany). PCR was performed using the primer pairs to amplify the DHX15 gene (primer forward ...
-
bioRxiv - Developmental Biology 2023Quote: Genomic DNA was extracted from mouse tail tip samples using the REDExtract-N-Amp Tissue PCR kit (Sigma-Aldrich). PCR was performed using the REDExtract-N-Amp PCR Readymix (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping was performed with REDExtract-N-Amp (Sigma Aldrich, St. Louis, MO, USA) using primers JAX oIMR9462 ATGCTCCAGACTGCCTTGGGAAAAG ...
-
bioRxiv - Biophysics 2019Quote: ... Peptide concentrations (Direct Detect spectrophotometer, Millipore) in injection buffer (5% HPLC grade acetonitrile ...
-
bioRxiv - Bioengineering 2021Quote: ... deionized water (Merck Millipore, Direct-QUV). These measurements were performed using as-polarized samples and samples one month after the polarization treatment ...
-
bioRxiv - Developmental Biology 2021Quote: ... TUNEL assay was conducted with ApopTag Fluorescin Direct In Situ Apoptosis Detection Kit (Millipore, Billerica, MA) on retinal cryosections according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... TUNEL assay was conducted with ApopTag Fluorescin Direct In Situ Apoptosis Detection Kit (Millipore, Billerica, MA) on retinal cryosections according to manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: ... All PCR products were purified with GenElute PCR Clean-Up Kit (Sigma) and sent for Sanger sequencing (Microsynth ...
-
bioRxiv - Pathology 2024Quote: Genotyping was performed as previously described 19 using the following primers (Sigma Aldrich; USA) for VHL floxed alleles ...
-
bioRxiv - Cell Biology 2022Quote: ... ear notches were collected from mouse pups to extract genomic DNA using the RED Extract-N-Amp Tissue PCR Kit (Sigma-Aldrich). Ear notches were incubated in the tissue preparation (25 μl/sample ...
-
bioRxiv - Plant Biology 2020Quote: ... and stained with Direct Red 23 (Sigma) as described (59) ...
-
bioRxiv - Microbiology 2021Quote: ... a Direct Detect Infrared Spectrometer (Merck Millipore). Concentrations of resuspended peptides were in the range of 20-70 mM ...
-
bioRxiv - Physiology 2023Quote: ... Picrosirius Red (Direct Red 80, Sigma 365548), anti-CD31 antibody (NBP1-49805 ...
-
bioRxiv - Neuroscience 2020Quote: ... The KAPA Taq PCR kit (Sigma, BK1000) was used in conjunction with three primer sequences (wild type ...
-
bioRxiv - Plant Biology 2023Quote: ... the KAPA3G Plant PCR Kit (Sigma-Aldrich) was used to amplify an 824 bp fragment spanning the gene target site using an initial touchdown for 6 cycles with annealing at 70°C decreasing by 1.6°C per cycle followed by 34 cycles annealing at 62.1°C ...
-
bioRxiv - Biochemistry 2023Quote: Mycoplasma PCR Detection Kit (LookOut, Sigma-Aldrich) Colloidal Blue Staining Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... The SYBR Green quantitative PCR kit (Sigma) was used with the following primers ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified using GenElute™ PCR Clean-Up Kit (Sigma-Aldrich), after restriction digestion of the PCR mixture with DpnI (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... PCR purification was performed using the GenElute PCR Clean-Up Kit (Sigma-Aldrich). Gibson assembly was done using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...