Labshake search
Citations for Millipore Sigma :
1 - 50 of 6742 citations for Lamin B1 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: si-lamin B1 (UUCCGCCUCAGCCACUGGAAAU, Sigma)
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-Lamin B1 (A5316, Sigma-Aldrich), mouse anti-β-actin (A2228 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cyclin B1 (mouse mAb; Millipore, 05-373), pT320 PPP1CA (rabbit mAb ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... LAMIN A/C (1:40, mouse mAb JOL2, Millipore MAB3211), Alexa Fluor 680 donkey anti-Rabbit IgG(H + L ...
-
bioRxiv - Cell Biology 2020Quote: ... Lamin B1 shRNA was expressed from pLKO.1 shRNA-LMNB1.71 puro (SHCLND-NM_005573, Sigma-Aldrich) containing the sequence ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were blocked in 5% dry milk power in PBS for 1 hour at RT and incubated overnight at 4°C in primary antibody (anti-Lamin B1 1µg/ml, Abcam ab16048, Cambridge, UK; anti-PCA NCAM 1:500, Millipore MAB5324 ...
-
bioRxiv - Genomics 2022Quote: ... Flag-NLS-M.CvIPI-Lamin-B1 dTAG-EZH2 knock-in cells were treated in duplicate with either 500 nM dTAG-13 (Sigma Aldrich) or vehicle (0.1% DMSO (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-lamin A (Sigma L1293, rabbit, WB: 1/2000), anti-γ-H2AX (Millipore 05-636 ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-Lamin A (1:500; L1293, Sigma-Aldrich), rabbit anti-Nup133 (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit polyclonal anti-Lamin A (C-terminal) (Sigma, L1293), rabbit monoclonal anti-Nup98 (C39A3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were incubated overnight at 4°C in primary antibodies (anti-lamin B1, ab16048, Abcam, 1:5000; anti-β-Actin, A1978, Sigma, 1:10,000) in 4% BSA/TBS + 0.025% sodium azide ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-lamin A antibody produced in rabbit (Sigma-Aldrich L1293-200UL), Mad1 (GeneTex ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibody dilutions for Rabbit Anti Lamin A antibody (Sigma Aldrich L1293), Anti Lamin B (Santacruz sc-6217 ...
-
bioRxiv - Cancer Biology 2021Quote: ... histone H3K27me3 (rabbit, mAb, clone C36B11, CST) histone H3 (mouse, mAb, clone 6.6.2, Millipore Sigma), RNA Polymerase 2 (rabbit polyclonal ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lamin A (Sigma) and then horseradish peroxidase-linked secondary antibodies (horse anti-mouse and horse anti-rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... polyubiquitin K63 (rabbit mAb, Millipore; 05-1308; 1:1000), polyubiquitin K48 (rabbit pAb ...
-
bioRxiv - Cell Biology 2020Quote: ... Cyclin B1 (Millipore; 05-373), PPP1CA (Bethyl ...
-
bioRxiv - Biochemistry 2023Quote: ... or fumonisin B1 (Sigma-Aldrich). Proteins were heated from 20 °C to 95 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Fumonisin B1 (FB1, Merck Sigma) treatment was performed on 5-day old seedlings grown on normal ½ MS plates that were transferred for 16 hours into multiwall plates containing liquid ½ MS medium with 2.5 µM FB1 ...
-
bioRxiv - Biochemistry 2022Quote: ... Primary antibodies used in this study were Rabbit Anti Lamin A (L1293 Sigma Aldrich, USA) in 1:500 and Mouse Anti β Actin (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... and Lamin 50 uG (Sigma) in 6-well cell-culture plates ...
-
bioRxiv - Developmental Biology 2020Quote: ... b1 or g1 chains (Sigma, L9393), goat anti-human EpCAM/TROP1 (R&D Systems ...
-
bioRxiv - Cell Biology 2019Quote: ... cyclin B1 (05–373; EMD Millipore), tubulin (T6199 ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.2% Thiamine B1 (Sigma Aldrich)] or LB broth [MgSO4 2.5g/L ...
-
bioRxiv - Immunology 2022Quote: ... 10uM Fumonisin B1 (Sigma-Aldrich, F1147), or 200uM oleic acid (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... 200 µM fumonisin B1 (Sigma-Aldrich), or 600 µM FTY720 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-acetylated tubulin 6-11-B1 (Sigma), or anti-HA HA7 (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cyclin B1 (Sigma, 1:1000, 70 kD), Securin (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-hnRNP A2/B1 from Sigma Aldrich Chemical Co ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-HNRNPA2/B1 (Sigma-Aldrich, cat# HPA001666); anti-HNRNPC (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... A MAb against actin (MAb AC-15; Sigma) was included as a loading control ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse α-Lamin A (Millipore; Cat# MAB3540), Mouse α-mono and poly ubiquitin (Enzo Life Sciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin A/C (Sigma-Aldrich; Cat#: SAB4200236), E-cadherin (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:10,000 for LAMIN A (Sigma, L1293); 1:50,000 for ACTIN (Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant rabbit anti-pan-ADP-ribose binding reagent MABE1016 (Merck Millipore) was used 1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... b1-integrin (1:50 dilution, clone MB1.2; Millipore, #MAB1997), b3-integrin-PE conjugated (1:100 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µM fumonisin B1 (FuB1, Cat. #F1147, Millipore Sigma), or 20 µM Fenofibrate (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:300 and 6-11 B1 (Sigma-Aldrich), an anti- acetylated α-tubulin antibody (1:2000 ...
-
bioRxiv - Neuroscience 2020Quote: ... (MAB 1501, Millipore Bioscience Research Reagents ...
-
bioRxiv - Cell Biology 2021Quote: ... α-Tubulin mAb (Sigma), Axin1 mAb (C76H11 Cell Signaling Technology) ...
-
bioRxiv - Biochemistry 2021Quote: ... α-tubulin mAb (Sigma).
-
bioRxiv - Molecular Biology 2024Quote: ... mouse mAb (Sigma) at 1:1000 (only used for Figure S1).
-
bioRxiv - Cell Biology 2020Quote: ... and 5 U ml−1 amphotericin B1 (all Sigma Aldrich). The skin was then dissected into 2-3 mm2 pieces using a surgical scalpel and 3 or 4 pieces placed per well of a 6-well dish (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2022Quote: Blocking component 1 (B1): 1 mg/ml mouse IgG (Sigma) in S2.
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-LAMIN A (Sigma, St. Louis, MO, cat # L1293), CRY1-CT and CRY2-CT as described in (Lamia et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... or anti-LaminA (Lamin A/C-Millipore 05-714) and 75 μl of Miltenyi protein G μMACS magnetic particles ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Lamin A (Sigma, cat. no. L1293, 1:1000). Uncropped Western blots are provided in supplementary figure 5.
-
bioRxiv - Microbiology 2021Quote: ... IE86 (mAb 810; Millipore), IRF7 (Santa Cruz ...
-
bioRxiv - Cell Biology 2022Quote: ... α-tubulin (mAb B512, Sigma) and acetylated-tubulin (mAb 6-11B-1 ...