Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for High mobility group protein B1 HMGB1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... and His-tagged human HDAC6 protein (EMD Millipore) were incubated with 57 nm 32P-ATP in kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Neuroscience 2019Quote: ... was incubated with recombinant His-tagged human HDAC6 protein (EMD Millipore) in 250 μl RB100 buffer (25 mM HEPES pH 7.5 ...
-
bioRxiv - Bioengineering 2022Quote: Gel mobility shift assays were performed using 2.5% high-resolution agarose (Sigma-Millipore) in 1x TAE and 2 mM magnesium acetate ...
-
bioRxiv - Bioengineering 2022Quote: Gel mobility shift assays were performed using 2.5% high-resolution agarose (Sigma-Millipore) in 1x TAE and 2 mM magnesium acetate ...
-
bioRxiv - Microbiology 2022Quote: ... and HEK293-ACE2 cells [HEK293 cells (ATCC CRL-1573) stably expressing human ACE2]22 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% FBS ...
-
bioRxiv - Biochemistry 2022Quote: Human embryonic kidney 293 cells (HEK293) (Sigma), HEK293T (TakaraBio) ...
-
bioRxiv - Biophysics 2021Quote: His-tagged human PCNA protein was purchased from Sigma Aldrich (catalogue number SRP5117), at a concentration of 6.6 μM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: HMGB1 levels were measured using a commercial kit (HMGB1 ELISA kit A76696, Sigma-Aldrich). The assay was performed as described in the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: HEK293 cells were cultured in high glucose DMEM (Sigma-Aldrich) containing 10% FBS (HyClone) ...
-
bioRxiv - Molecular Biology 2019Quote: ... His-GFP or His-fusion proteins were bound to HIS-Selec HF Nickel Affinity Gel (Sigma) for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 (Human Embryonic Kidney, ECACC 96121229 from Sigma-Aldrich Chemie GmbH) were cultured in DMEM (Dulbecco’s modified Eagle’s medium PAN biotech ...
-
bioRxiv - Microbiology 2019Quote: ... Bound His-tagged proteins were detected using HRP-conjugated anti-His antibodies (Sigma) at a 1:500 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 μg of purified His fusion protein (PuBZR1-His) was bound to Ni-NTA His binding resin (Novagen). GST fusion proteins containing PuACO1 (PuACO1-GST ...
-
bioRxiv - Biochemistry 2020Quote: ... Inhibition of the synergistic activity of the CXCL12/HMGB1 heterocomplex was obtained by incubating CXCL12 and HMGB1 with 200 µM glycyrrhizin (Sigma Aldrich), as positive control7 ...
-
bioRxiv - Systems Biology 2021Quote: ... separated proteins were transferred to a PVDF membrane using a semi-dry system and His-tagged proteins (hCDKL5 and His-Neuropilin) were detected with a HRP-conjugated anti-His antibody (1:2,000, Sigma) using the Enhanced Chemiluminescence kit (ECL ...
-
bioRxiv - Genetics 2019Quote: ... HEK293 cells were cultured in high glucose Dulbecco’s modified Eagle’s medium (DMEM; Sigma) supplemented with 10% fetal bovine serum at 37°C in 5% CO2 ...
-
bioRxiv - Plant Biology 2021Quote: ... Fusion proteins with His tag were purified using Ni-NTA His binding resin (Novagen) and those with GST tag was purified by glutathione sepharose (Novagen).
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were purified with His-Bind Resin and His-Bind Buffers (Merck Millipore) according to manufacturer’s protocol and stored at a concentration of 2mg/ml in elution buffer (Merck Millipore ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were detected using anti-His-HRP (Sigma) and anti-FLAG-HRP (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: si-lamin B1 (UUCCGCCUCAGCCACUGGAAAU, Sigma)
-
bioRxiv - Cell Biology 2020Quote: ... Cyclin B1 (Millipore; 05-373), PPP1CA (Bethyl ...
-
bioRxiv - Biochemistry 2023Quote: ... or fumonisin B1 (Sigma-Aldrich). Proteins were heated from 20 °C to 95 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Fumonisin B1 (FB1, Merck Sigma) treatment was performed on 5-day old seedlings grown on normal ½ MS plates that were transferred for 16 hours into multiwall plates containing liquid ½ MS medium with 2.5 µM FB1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fractions containing His-tagged protein as verified by Western blot with an anti-His antibody (Sigma) were pooled and loaded onto the StrepTrap column ...
-
bioRxiv - Cell Biology 2020Quote: ... and Hek293 (ATCC CRL-1573, embryonic kidney) were cultured in DMEM high glucose (Sigma-Aldrich), all supplemented with 2mM glutamine (Biochrome) ...
-
Evolutionary plasticity of SH3 domain binding by Nef proteins of the HIV-1/SIVcpz lentiviral lineagebioRxiv - Microbiology 2021Quote: ... HEK293 and HZ1 cells were grown in high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Sigma) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2020Quote: ... His-tagged proteins were immobilized on Ni-NTA His-Bind® Superflow™ Resin (Merck Millipore, 70691), washed and eluted in SB buffer (30 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies used for protein quantification for ELISAs were mouse monoclonal anti-His (His-Tag mAb, EMD-Millipore), and biotinylated mouse anti-rat Cd4 (clone OX68) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 6×His-tagged protein were expressed and purified by Ni-NTA His Bind Resin (Millipore 70666-3). ∼0.2 μg of GST-OsBZR1 ...
-
bioRxiv - Biochemistry 2021Quote: ... a high-copy plasmid from a different incompatibility group (pBR223 origin of replication; Novagen) containing the lacIq repressor ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Genomics 2020Quote: ... mouse monoclonal anti-HMGB1/2 (1:1000; Sigma-Aldrich 12248-3D2); rabbit polyclonal anti-CTCF (1:500 ...
-
bioRxiv - Developmental Biology 2020Quote: ... b1 or g1 chains (Sigma, L9393), goat anti-human EpCAM/TROP1 (R&D Systems ...
-
bioRxiv - Cell Biology 2019Quote: ... cyclin B1 (05–373; EMD Millipore), tubulin (T6199 ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.2% Thiamine B1 (Sigma Aldrich)] or LB broth [MgSO4 2.5g/L ...
-
bioRxiv - Immunology 2022Quote: ... 10uM Fumonisin B1 (Sigma-Aldrich, F1147), or 200uM oleic acid (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... 200 µM fumonisin B1 (Sigma-Aldrich), or 600 µM FTY720 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were detected using α -His from mouse (Sigma H1029), α-Gfp from mouse ...
-
bioRxiv - Developmental Biology 2022Quote: ... Subsequently protein thiol groups were blocked with 10mM iodoacetamide (Sigma-Aldrich, USA) at RT for 45 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Subsequently protein thiol groups were blocked with 10mM iodoacetamide (Sigma-Aldrich, USA) at RT for 45 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Changes in electrophoretic mobility were assessed via immunoblotting with FLAG (Sigma F3165), HA (Sigma H3663) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultured human embryonic kidney 293 (HEK293) cells were transfected using 2 μg/μl polyethylenimine (Sigma-Aldrich) with indicated plasmids for the expression of either Flag-KCTDs alone or in combination with Flag-Cav2.3 ...
-
bioRxiv - Neuroscience 2019Quote: ... and PAK/cofilin mechanism experiments used human embryonic kidney cells (HEK293) cultured in DMEM:F12 (Sigma, D6421) supplemented with 10% foetal bovine serum (ClonTech ...
-
bioRxiv - Microbiology 2021Quote: ... His-tagged recombinant proteins were detected using an HRP-conjugated anti-His monoclonal antibody (Sigma-Aldrich, St. Louis, MO) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... His- and GST-tagged proteins were detected with anti-His (Monoclonal Anti-polyHistidine antibody, Sigma H1029, 1:5000 dilution) or anti-GST (Mouse anti-GST monoclonal antibody ...
-
bioRxiv - Biophysics 2021Quote: ... the proteins were purified using His-Select Nickel agarose resin (Sigma) and anion exchange chromatography (Source Q ...
-
bioRxiv - Plant Biology 2022Quote: PIF3 recombinant proteins were prepared using PIF3-his DNA (pET28C, Novagen) provided by Ferenc Nagy and induced and purified using commercial kit (Amersham) ...
-
bioRxiv - Plant Biology 2019Quote: ... His-tagged recombinant protein was eluded with 250 mM imidazole (Sigma).
-
bioRxiv - Plant Biology 2021Quote: ... Fusion proteins were purified using Ni2+-containing His-Bind columns (Novagen). Purified proteins were desalted and concentrated by ultracentrifugation (Amicon ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-acetylated tubulin 6-11-B1 (Sigma), or anti-HA HA7 (Sigma) ...