Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Fipronil 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... N- (Piperidin-1-yl)-5- (4-iodophenyl)-1- (2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251, 3 mg/kg; Sigma Aldrich, St. Louis, MO), or vehicle (VEH ...
-
bioRxiv - Biochemistry 2020Quote: ... methanol and α-Cyano-4-hydroxycinnamic acid (CHCA) were purchased from Sigma. Polyimide coated fused silica capillary (75 μm ID ...
-
The cellular basis of protease activated receptor type 2 (PAR2) evoked mechanical and affective painbioRxiv - Neuroscience 2020Quote: ... and 3 ug/ml 5-fluoro-2’-deoxyuridine + 7 ug/ml uridine (FRD+U; Sigma) added ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 0.5 μL of matrix solution (5 mg/mL α-cyano-4-hydroxycinnamic acid from Sigma-Aldrich dissolved in 50% acetonitrile containing 0.1% trifluoroacetic acid ...
-
bioRxiv - Bioengineering 2020Quote: ... α-Cyano-4-hydroxycinnamic acid (Sigma) was added together with lactate ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’-GACAUAUUUGAUAAACUUAAA-3’, 5’-GUUAUCAGUCUGAGCCAGG-3’), human DRP1 (5’-GCAGAAGAAUGGGGUAAAU-3’, 5’-UCCGUGAUGAGUAUGCUUU-3’, 5’-GAGGUUAUUGAACGACUCA-3’) non-targeting scrambled siRNA (Sigma, SIC001-1NMOL) for 48-72 hours using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... and overlaid with 0.5 μl of the matrix solution (α-cyano-4-hydroxycinnamic acid in 50% acetonitrile/0.1% TFA; 5 mg/ml, Sigma). Peptide mass maps of proteins in Figures 4f ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Biochemistry 2024Quote: ... Tspan12 siRNA duplexes (#1: 5’-GCUUAUCUUUGCCUUCUCCTT-3’ and 5’-GGAGAAGGCAAAGAUAAGCTT-3’; #2: 5’-AUGAGGGACUACCUAAAUATT-3’ and 5’-UAUUUAGGUAGUCCCUCAUTT-3’) (Sigma) using Lipofectamine RNAiMax (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO.1-puro-CMV-tGFP plasmids targeting SNX5 (5’-ACTATTACAATAGGATCAAAG-3’, 5’-CTGAGTATCTCGCTGTGTTTA-3’) and SNX6 (5’-AGTAAAGGATGTAGATGATTT-3’, 5’-GCCGAAACTTCCCAACAATTA-3’) (Sigma-Aldrich) were lentivirally transduced ...
-
bioRxiv - Cancer Biology 2021Quote: ... MYC forward 5’-TGAGGAGGAACAACAAGATG-3’ and reverse 5’-ATCCAGACTCTGACCTTTTG-3’ and GAPDH forward 5’-CTTTTGCGTCGCCAG-3’ and reverse 5’-TTGATGGCAACAATATCCA-3’) (Sigma-Aldrich), the Radian SYBR Green Lo-ROX qPCR Kit (Alkali Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The sequences of forward and reverse primers for εGLT (fw: 5′-CTGTCCAGGAACCCGACAGA-3′; rev: 5′-TGCA GCAGCGGGTCAAG-3′) and γ1GLT (fw: 5’-CCAGGGCAGGGTCAGCA-3’; rev: 5’-GGTGCTCTTGGAGGAGGGT-3’) (Sigma-Aldrich) and their corresponding FAM-labelled MGB probes (εGLT ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Bioengineering 2021Quote: ... 5□μL 3-aminopropyltriethoxysilane (APTES) 99% (Sigma-Aldrich cat. no. 440140) was added ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Neuroscience 2021Quote: ... α-cyano-4-hydroxycinnamate (4-CIN, 250 µM, Sigma-Aldrich); iodoacetic acid (IAA ...
-
bioRxiv - Genetics 2023Quote: ... Doxycycline (3 ug/ml, Sigma Aldrich) was added to induce TetO gene expression ...
-
bioRxiv - Cell Biology 2019Quote: ... (TDP43: 5’-gcaaagccaagaugagccu-3’ and EGFP control: 5’-gcaccaucuucuucaagga-3’; Sigma). Silenced cells were collected by trypsinization ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µL of sample was mixed with 4 µL of TLC-MALDI buffer (MB, 5 mg/mL α-cyano-4-hydroxycinnamic acid (CHCA, Sigma-Aldrich), 25% acetonitrile ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 mg/ml α-cyano-4-hydroxycinnamic acid (CHCA; Sigma, MO, USA) added to 50% acetonitrile was applied with an HTX M5 sprayer.
-
bioRxiv - Microbiology 2019Quote: ... and [5-(2-thienyl)-3-isoxazolyl]methanol were obtained from Sigma-Aldrich, MO (Table 1) ...
-
bioRxiv - Cell Biology 2020Quote: ... MALDI matrix α-cyano-4-hydroxycinnamic acid (CHCA, Sigma; 50% acetonitrile/0.1% trifluoroacetic acid ...
-
bioRxiv - Microbiology 2023Quote: ... 3 ug/mL catalase (Sigma-Aldrich #C3515) in a 1x TBS solution.
-
bioRxiv - Cell Biology 2022Quote: ... followed immediately by an equal volume of a freshly-prepared 5 mg/mL solution of 4-hydroxy-α-cyano-cinnamic acid (Sigma) in 50% aqueous (v:v ...
-
bioRxiv - Microbiology 2023Quote: ... and eluted directly onto the MALDI plate using 1 μL of 5 mg/mL alpha-cyano-4-hydroxycinnamic acid (CHCA, Sigma-Aldrich) in 50% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-GATCCCCAAATCT-3’ and 5’-GATCAGAT[BtndT]TGGG-3’ with 5’ end phosphate (Sigma-Aldrich), were annealed (81 µl of each Oligo 100 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense: 5’-ACCGAUUGAAGUUAAUGUC-3’), Myef2 (sense: 5’-CUUUGGUGGAGUUGGCCGA-3’, antisense: 5’-UCGGCCAACUCCACCAAAG-3’) or siRNA universal negative control (SIC001, Sigma-Aldrich) were purchased from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 mg/ml alpha-cyano-4-hydroxycinnamic acid (CHCA, Sigma-Aldrich, Munich, Germany) matrix was prepared in 50% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mg/mL a-cyano-4-hydroxycinnamic acid (HCCA, Sigma, St. Louis, MO) in 50% acetonitrile ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2019Quote: ... and primers p181 (5’-GCGAAGATAACAGTGACTCTA-3’ and p54 (5’-CGGCTCTGATTAAATTCTGAAG-3’) (Sigma, UK).
-
bioRxiv - Neuroscience 2023Quote: ... and Anisole (CAS #100-66-3, purity >98%, Sigma Aldrich), 3-Hexanol (CAS #623-37-0 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... We mixed the resulting peptides with a MALDI matrix consisting of an aqueous 50% acetonitrile/0.1% TFA solution of α-cyano-4-hydroxycinnamic acid (5 mg/ml; Sigma-Aldrich, www.sigmaaldrich.com). We measured mass spectra using an Ultraflex III MALDI-TOF (Bruker Daltonics ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10-5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, C127; Sigma-Aldrich).
-
Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide releasebioRxiv - Neuroscience 2023Quote: ... and 10-5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, C127; Sigma-Aldrich) were added to perfusion aCSF ...
-
bioRxiv - Microbiology 2019Quote: ... MH agar was supplemented with 100 μg/mL XS (5-bromo-4-chloro-3-indolylsulfate (Sigma-Aldrich)) with or without 0.35 μg/mL anhydrotetracycline (ATc ...
-
bioRxiv - Biochemistry 2022Quote: ... Cytidine 3′, 5′ cyclic monophosphate (3′, 5′ cCMP) and Cytidine 2′, 3′ cyclic monophosphate (2′, 3′ cCMP) were purchased from Sigma-Aldrich (Bangalore, India) and used without further purification ...
-
bioRxiv - Cell Biology 2022Quote: Chemicals and solvents (analytical grade) were purchased from the following sources: α-Cyano-4-hydroxycinnamic acid 98% (CHCA) (Sigma Aldrich), 1,5-Diaminonaphthalene 97% (DAN ...
-
bioRxiv - Biochemistry 2021Quote: Chemicals and solvents (analytical grade) were purchased from the following sources: α-Cyano-4-hydroxycinnamic acid 98% (CHCA) (Sigma Aldrich), 2,5-Dihydroxybenzoic acid 98% (DHB ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine 5’-triphosphate (BzATP) (#B6396, Sigma-Aldrich), 20 µM MCC950 (#inh-mcc ...
-
bioRxiv - Pathology 2022Quote: ... 10 mg/mL α-cyano-4-hydroxycinnamic acid (CHCA) (Sigma-Aldrich, St. Louis, MO) in 50% acetonitrile ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone) (SIGMA, USA) carrying the corresponding binary plasmids (Table 1) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...