Labshake search
Citations for Millipore Sigma :
1 - 50 of 67 citations for Cyclin B1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Cyclin B1 (Millipore; 05-373), PPP1CA (Bethyl ...
-
bioRxiv - Cell Biology 2019Quote: ... cyclin B1 (05–373; EMD Millipore), tubulin (T6199 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cyclin B1 (Sigma, 1:1000, 70 kD), Securin (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... Cyclin B1 (mouse mAb; Millipore, 05-373), pT320 PPP1CA (rabbit mAb ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-cyclin B1 (Clone GNS3; 1:2000; Merck Millipore 05-373), mouse anti-cyclin A2 (clone BF683 ...
-
bioRxiv - Cell Biology 2021Quote: ... or immunoprecipitating mAbs (mouse anti–cyclin B1 clone GNS3 or mouse anti–cyclin A clone E67.1; SC53230; Santa Cruz Biotechnology, Inc., or mouse IgG; Sigma-Aldrich) were added to the lysate (2 μg/ml cyclin B1 and 10 μg/ml cyclin A final concentration ...
-
bioRxiv - Immunology 2020Quote: ... Fam72a+/+ CH12 cells (20 × 104 cells/mL) were cultured 20 hours with 10uM of CDK1/cyclin B1 inhibitor RO-3306 (Sigma), followed by exchange into inhibitor-free culture media ...
-
bioRxiv - Cell Biology 2019Quote: ... Supernatants from 11.000 x g centrifugation of cell lysates were incubated with anti-Cyclin B1 (GNS1, Pharminogen) or anti-MAD1 (9B10, Sigma-Aldrich) antibodies coupled to Protein G-Dynabeads (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Human recombinant Cdk9/cyclin K and CDK9/cyclin T (Sigma Aldrich) were incubated with the substrate at 30°C for 30 minutes in reaction buffer (25 mM Tris-acetate (pH 7.9) ...
-
bioRxiv - Cell Biology 2020Quote: si-lamin B1 (UUCCGCCUCAGCCACUGGAAAU, Sigma)
-
bioRxiv - Cell Biology 2023Quote: ... Fumonisin B1 (FB1, Merck Sigma) treatment was performed on 5-day old seedlings grown on normal ½ MS plates that were transferred for 16 hours into multiwall plates containing liquid ½ MS medium with 2.5 µM FB1 ...
-
bioRxiv - Biochemistry 2023Quote: ... or fumonisin B1 (Sigma-Aldrich). Proteins were heated from 20 °C to 95 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cyclin E (1:1000, Sigma Aldrich), V5 (1/500 ...
-
bioRxiv - Developmental Biology 2020Quote: ... b1 or g1 chains (Sigma, L9393), goat anti-human EpCAM/TROP1 (R&D Systems ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.2% Thiamine B1 (Sigma Aldrich)] or LB broth [MgSO4 2.5g/L ...
-
bioRxiv - Immunology 2022Quote: ... 10uM Fumonisin B1 (Sigma-Aldrich, F1147), or 200uM oleic acid (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... 200 µM fumonisin B1 (Sigma-Aldrich), or 600 µM FTY720 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... 2.5 µg cyclin A2/CDK2 (Sigma, #C0495), 60 µCi [γ-32P]-ATP ...
-
bioRxiv - Immunology 2022Quote: ... 20 µM DTT and phosSTOP in the presence of recombinant cyclin A2/cyclin-dependent kinase (CDK)1 (Sigma-Aldrich) and 10 mM ATP incubated for 2 h at 30 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-acetylated tubulin 6-11-B1 (Sigma), or anti-HA HA7 (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-Lamin B1 (A5316, Sigma-Aldrich), mouse anti-β-actin (A2228 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-hnRNP A2/B1 from Sigma Aldrich Chemical Co ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-HNRNPA2/B1 (Sigma-Aldrich, cat# HPA001666); anti-HNRNPC (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit anti-Cyclin D (1:1000, Millipore RRID:AB_10562237), mouse IgG1 anti-alpha tubulin ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cyclin-E1 (rabbit, 1:1000, Sigma-Aldrich, cat# C4976), GFP (mouse ...
-
bioRxiv - Genetics 2022Quote: ... 1:100 for Cyclin A (Millipore Sigma, ZRB-1590), 1:50 for Myogenin (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cyclin A antibody was purchased from Sigma (Cat # C4710).
-
bioRxiv - Cell Biology 2022Quote: ... b1-integrin (1:50 dilution, clone MB1.2; Millipore, #MAB1997), b3-integrin-PE conjugated (1:100 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µM fumonisin B1 (FuB1, Cat. #F1147, Millipore Sigma), or 20 µM Fenofibrate (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:300 and 6-11 B1 (Sigma-Aldrich), an anti- acetylated α-tubulin antibody (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 U ml−1 amphotericin B1 (all Sigma Aldrich). The skin was then dissected into 2-3 mm2 pieces using a surgical scalpel and 3 or 4 pieces placed per well of a 6-well dish (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2022Quote: Blocking component 1 (B1): 1 mg/ml mouse IgG (Sigma) in S2.
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Quantification with aflatoxin B1 and B2 standards (Sigma-Aldrich A6636-5MG) was based on a six-point calibration curve in the range of 0.001-0.5 µg/mL ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Enn B1 and TEN were purchased from Sigma-Aldrich (Vienna, Austria). Dihydrocitrinone (DH-CIT ...
-
bioRxiv - Cell Biology 2022Quote: ... b1-integrin (1:1000 dilution, Rat monoclonal, clone MB1.2; Millipore, #MAB1997), HSC70 (1:5000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 20 ng of purified Cyclin A/Cdk1 (Sigma cat. #CO244, lot SLBW3287) were incubated in kinase buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... 40 nM of the non-degradable cyclin BΔ90 and 10 µM nocodazole (Sigma). After 60 min at metaphase ...
-
bioRxiv - Genetics 2019Quote: ... mouse anti-acetylated tubulin (clone 6-11-B1, Sigma-Aldrich, T6793; 1:1,000), mouse anti-ARL13B (UC Davis NeuroMab 75-287 clone N295B/66 ...
-
bioRxiv - Genomics 2023Quote: ... and Cap B (B1:B2 1:1; BI0347-0505, BI0349-0505 Sigma-Aldrich) reagents ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4) Ceramide rescue experiments using 0.02 mg/ml Fumonisin B1 (Sigma F1147) and 20 μM myriocin (Sigma M1177 ...
-
bioRxiv - Neuroscience 2019Quote: To block cell proliferation the cyclin-dependant kinase (CDK) inhibitors Olomoucine and Ryuvidine (Sigma) where applied ...
-
bioRxiv - Cancer Biology 2024Quote: ... phospho-Rb (Ser793) 9301 and cyclin D1 2978 and beta-actin antibody was from Sigma A2228 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lamin B1 shRNA was expressed from pLKO.1 shRNA-LMNB1.71 puro (SHCLND-NM_005573, Sigma-Aldrich) containing the sequence ...
-
bioRxiv - Biochemistry 2023Quote: ... the SEC-purified CerS6-Nb22 complex was incubated with 120 µM fumonisin B1 (Sigma-Aldrich) for 10 minutes on ice prior to protein concentration and subsequently for an additional 2h on ice prior to grid preparation ...
-
bioRxiv - Genetics 2019Quote: ... anti-acetylated tubulin antibody (mouse, clone 6-11-B1, Sigma-Aldrich, cat. no. T6793; 1:1,000), and anti-GT335 (mouse ...
-
bioRxiv - Cell Biology 2020Quote: Immunodepletion of Cyclin A from Xenopus embryo extracts was carried out using AffiPrep Protein A beads (Sigma) conjugated with the Xenopus laevis anti-Cyclin A1 (a gift from Daniel Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were incubated with one of the following primary antibodies: anti-cyclin G2 (1:500, HPA034684, Sigma); Flag (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... The slides were then incubated in blocking Buffer B2 (10% Sheep serum [Sigma S3772] in Buffer B1) at room temperature for a minimum of one hour ...
-
bioRxiv - Cell Biology 2019Quote: ... GST (clone 8-326, MA4-004 from Thermo Fischer, 1:1000) and Cyclin B (C8831 from Sigma, 1:1000). The secondary antibodies used for Western blotting were goat ⍰ -mouse IgG HRP conjugate (170-6516 from Bio-Rad ...