Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Cow Four And A Half LIM Domains Protein 2 FHL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Goat and cow whey protein were purchased from Sigma (USA). The recombined lactoferrin (rLF) ...
-
bioRxiv - Microbiology 2020Quote: ... Goat and cow whey proteins were purchased from Sigma (USA). Heparin was purchased from Sigma (USA) ...
-
bioRxiv - Cell Biology 2021Quote: ... FHL2 (1:200; HPA006028; Sigma), and TFE3 (1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA targeting the LIM domain of EPLIN (# SASI_Hs02_00326071; TATTGTAAGCCTCACTTCAA) and a scrambled control siRNA (#SIC001) were obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2020Quote: ... Purified proteins were diluted to a final concentration of 50 mM NaCl and then concentrated on Amicon centrifugal filters 30K for FHL and 10K for LIM domains (Millipore). The proteins’ purities and identities were confirmed by SDS-PAGE and mass spectrometry ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (R)-(+)-Limonene (lim, Sigma-Aldrich #183164), polygodial (polyg ...
-
bioRxiv - Bioengineering 2023Quote: ... AS Diagnostik) and polyclonal rabbit anti-human FHL2 (2 µg/mL, HPA006028, Sigma/Prestige Antibodies) was performed at 4 °C overnight in PBS/10% AB serum ...
-
bioRxiv - Bioengineering 2023Quote: ... anti-FHL2 (0.5 µg/mL, HPA006028, Sigma/Prestige Antibodies). The secondary antibodies are ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 10 % Bovine Cow Serum (BCS; Sigma 12133C) and 1 % Penicillin/Streptomycin (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... A four-molar excess of scaffold protein (MSP1E3D1, Sigma) was added to the protein-lipid mix ...
-
bioRxiv - Pathology 2021Quote: ... Japan) were immunized (four times at 2-week intervals) with the purified protein conjugated to TiterMax Gold (Sigma-Aldrich). Rabbits were sacrificed under excess anesthesia with pentobarbital sodium (64.8 mg/kg) ...
-
bioRxiv - Cell Biology 2019Quote: ... and rat/mouse c-peptide ELISA kit (cat # EZRMCP 2-21K, Millipore MA).
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Cancer Biology 2024Quote: mTOR kinase domain protein was purchased from Sigma-Aldrich (Cat # 14-770). ETV7 protein (Cat # TP307742 ...
-
bioRxiv - Bioengineering 2020Quote: ... Bound proteins were eluted by competition with four 2 x CV of DPBS containing 100 µg/mL FLAG peptide (Sigma Aldrich). Purified proteins were formulated in DPBS by buffer exchange through desalting columns (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... Release of IL-2 into supernatant was measured using a commercial ELISA kit (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2023Quote: ... One half was used for protein extraction and the other half used for UA quantification using a UA Assay Kit (MAK077, Sigma-Aldrich). Cells were disrupted mechanically ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S1 domain (ACRO biosystems – S1N-C52H3) or BSA (Sigma – A7906) overnight at 4°C in 50 μl/well ...
-
bioRxiv - Developmental Biology 2019Quote: For protein half-life analysis cells were treated with 10μg/ml cyclohexamide (Sigma Aldrich) for 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... propionic acid and 2-butanone (these four odorants purchased from Sigma-Aldrich), and female stonefly ...
-
bioRxiv - Plant Biology 2019Quote: ... for the HMA domains in pGBKT7 and anti-GAL4 activation domain (Sigma) antibodies for the AVR-Pik effectors in pGADT7.
-
bioRxiv - Plant Biology 2020Quote: ... for the HMA domains in pGBKT7 and anti-GAL4 activation domain (Sigma) antibodies for the AVR-Pik effectors in pGADT7.
-
bioRxiv - Microbiology 2021Quote: ... the antibodies isotypes were determined by ELISA using a mouse Ig isotyping kit (ISO-2, SIGMA).
-
bioRxiv - Molecular Biology 2020Quote: ... coli ProQ protein or its N-terminal domain (NTD) were cloned into pET15b vector (Novagen) using BamHI restriction site (Supplemental Table S2) ...
-
bioRxiv - Plant Biology 2023Quote: ... antibody for the OsExo70F3 protein in pGBKT7 and with the anti-GAL4 activation domain (Sigma) antibody for AVR-Pii and ZiF effectors in pGADT7.
-
bioRxiv - Neuroscience 2023Quote: ... the anterior half of the larva was incubated in 2 % formaldehyde fixative (Sigma-Aldrich, Germany) with 2.5 % glutardialdehyde in 0.1 M Na-cacodylate buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... Plants were transferred to half MS medium (Control, C) or half MS + EDTA (Sigma) medium (Induced but not flowered ...
-
bioRxiv - Cell Biology 2022Quote: ... were detected by ELISA Kits (from Millipore) within 24h according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... STAR EGFR ELISA Kit (Millipore, Billerica, MA) and followed by manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... Cardiac Muscle ELISA Kit (RAB0634, Sigma-Aldrich), and 100 uL of cell culture supernatant after 24 hours of treatment with each drug at 0.5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... C-reactive protein (CRP) was measured by an ELISA kit (cat. number CYT294, Millipore Sigma, Saint Louis, MO) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... or cell culture supernatants were quantified by ELISA methods (Activin A ELISA kit, Sigma, St ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Serum insulin levels were determined by ELISA using mouse insulin ELISA kit from Sigma according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2020Quote: ... half cOmplete (4693159001, Sigma-Aldrich) for 3mL buffer ...
-
bioRxiv - Molecular Biology 2021Quote: Half of the native protein extract was pre-treated with 0.625 U/μL Benzonase (Millipore, E1014) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Cell Biology 2020Quote: ... The bound protein was eluted four times with 250 μL of HA peptide (Sigma-Aldrich) (0,1 mg/ml).
-
bioRxiv - Physiology 2020Quote: ... and each circulating hormones were determined using a commercially available ELISA kit for total ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-91K, Millipore), and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit ...
-
bioRxiv - Bioengineering 2020Quote: ... human VEGF ELISA kit (RAB0507-1KT, Sigma Aldrich), glutaraldehyde solution (340855 ...
-
bioRxiv - Cell Biology 2021Quote: ... ALP activity was determined by ELISA kit (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... mouse FGF21 ELISA kit (Sigma-Aldrich, EZRMFGF21-26K).
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse IL-6 ELISA kit (Sigma, RAB0309), anti-mouse G-CSF ELISA kit (MCS00 ...
-
bioRxiv - Plant Biology 2021Quote: ... The solution containing microbes was evenly spread on half strength (1/2) PDA medium (SLBT9643, Sigma, USA). Microbial colonies were selected and streaked on a new plate ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Pathology 2023Quote: ... adiponectin levels were measured by enzyme-linked immunosorbent assays (Human Chemerin ELISA kit, Biovendor, Brno, Czech Republic; Human Resistin ELISA kit, Millipore Sigma; Human Total Adiponectin/Acrp30 Quantikine ELISA Kit ...
-
bioRxiv - Bioengineering 2021Quote: ... Four different target Fc-proteins were used in this study: hIgG (Sigma-Aldrich, St. Louis, MO), plant-expressed rCMG2-Fc ...
-
bioRxiv - Neuroscience 2020Quote: ... Half fresh medium containing Amyloid β Protein Fragment 1-42 (50 nM; Sigma-Aldrich, St. Louis, MO, USA) or DMSO (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: We used ELISA kits to detect the concentrations of inflammatory mediators such as TNF-α (KIT ELISA TNF-a-RAB0477-1KT, Sigma-Aldrich) and IL-6 (KIT ELISA IL-6-RAB0308-1KT ...
-
bioRxiv - Molecular Biology 2021Quote: ... The levels of Aβ40 and Aβ42 were quantified by sandwich ELISA using Aβ40 and Aβ42 EZbrain ELISA kit (EMD Millipore) following the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2023Quote: FGF21 ELISA was performed following the manufacturer’s guidelines (FGF21 ELISA kit, Millipore Sigma catalogue number-EZRMFGF21-26K).