Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Caspase 9 CASP9 Antibody Pair since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... anti-human Caspase-1 antibody (06-503, Merck Millipore); anti-mouse IL-1β antibody (5129-100 ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.5 μM (with apoptosome at a molar ratio of 1:5:10 caspase-9 : Apaf-1 : cytochrome C (SIGMA)) in the following buffer conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Caspase-3 antibody (Sigma USA, Dubey and Tapadia, 2017) was used at a dilution of 1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... then primary antibody (goat anti-ChAT 9 Millipore AB144P) placed in block overnight at 4°C ...
-
bioRxiv - Systems Biology 2023Quote: Caspase-9 activity was measured in liver lysate according to manufacturer’s protocol (Merck Caspase-9 Colorimetric Activity Assay Kit APT139, EMD Millipore Corporation, USA). In brief ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antibodies against Caspase-2 (MAB3507) and MDM2 (MABE340) were from EMD Millipore Corporation (Burlington ...
-
bioRxiv - Cell Biology 2021Quote: The following antibodies were used: anti-Caspase-2 (clone 11B4 from Millipore); anti-phospho-ATM (Ser1981 ...
-
bioRxiv - Immunology 2021Quote: ... NLRP3 primer pair (Sigma): forward 5’ -TCAGCACTAATCAGAATCTCACGCACCTTT -3’ and reverse 5’ -CCAGGTCATTGTTGCCCAGGCTC -3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Primer pairs (Sigma Aldrich) are listed in the table below ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers pairs (Sigma-Aldrich) specific for Il6 ...
-
bioRxiv - Cell Biology 2023Quote: ... The primary antibodies included anti-phospho-Smad1/5/9 antibody (Millipore, AB3848-1, rabbit), anti-RUNX2 antibody (CST ...
-
bioRxiv - Cancer Biology 2020Quote: ... septin-9 (catalog number: HPA029524) antibodies were purchased from Sigma Aldrich Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase inhibitor (Sigma, 400012) at 1 and 5 μM ...
-
bioRxiv - Plant Biology 2021Quote: ... Two pairs of oligos (Sigma) corresponding to the consensus gRNA target site in exon two of MYB186 (Potri.008G089200) ...
-
Obesity alters mobility and adult neurogenesis, but not hippocampal dependent learning in ob/ob micebioRxiv - Neuroscience 2019Quote: ... the solution containing the primary rabbit anti-active Caspase 3 antibody (Merck Millipore, Germany) was applied 1:100 in blocking serum (3 % NGS + 0.1 % Triton X-100 in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... cleaved Caspase-3 Asp175 (5A1E #96641:1000) and anti-FLAG M2 antibody (Sigma, #F1804). HRP-conjugated secondary antibody was used at a dilution of 1:5000 (Jackson Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Caspase 3 (rabbit; Millipore); anti-Crabp1 (rabbit ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were then probed with primary antibodies specific for murine caspase-11 (#C1354; Sigma-Aldrich), caspase-3 (#9662 ...
-
bioRxiv - Immunology 2019Quote: ... using the following primer pairs (Sigma): bActin For 5’GTTCCGATGCCCTGAGGCTC3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... Oligonucleotide pairs incorporating these sequences (Sigma) were annealed (at 50mM ea. ...
-
bioRxiv - Microbiology 2020Quote: ... #9 (Sigma, #70050), #135 (AldrichSelect #361173301) ...
-
bioRxiv - Bioengineering 2023Quote: ... and Anti-Adeno-associated Virus 9 Antibody clone HL2374 (Millipore Sigma, #MABF2326-25UG). Following three additional washes ...
-
bioRxiv - Microbiology 2023Quote: ... 9-O-acetyl (clone UM4D4; isotype-control antibody mouse IgM κ; Millipore Sigma). Cells were stained with CD13 ...
-
bioRxiv - Developmental Biology 2022Quote: Caspase 3 activity was measured using the Caspase-3 Colorimetric Activity Assay Kit (APT131, Millipore). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... 9 mM citric acid (pH 6.0) (Sigma Aldrich, 77-92-9), 0.1% Tween20 (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... or goat-anti-MMP-9 (Matrix metallopeptidase 9, Sigma-Aldrich M9570). Both antibodies were diluted in the blocking solution with 0.2% Triton X-100 (1:1000 and 1:500 for anti-NeuN and anti-MMP-9 ...
-
bioRxiv - Cancer Biology 2019Quote: ... rabbit anti-caspase-3 (Sigma; C8487), rabbit anti-Foxp3 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and anti-caspase 3 (Sigma-Aldrich) diluted 1,00 times with Can Get Signal Immunoreaction Enhancer Solution 1 (Toyobo ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.25 μM primer pair (Sigma, Dublin, Ireland) and RNAse free water (Invitrogen CA ...
-
bioRxiv - Immunology 2022Quote: ... The sequences of primer pairs (Sigma-Aldrich) specific for murine Gapdh (Forward ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed with primer pairs (Sigma) listed in Table S1 ...
-
bioRxiv - Genetics 2023Quote: ... Pairs of oligonucleotides were ordered (Sigma-Aldrich) and annealed ...
-
bioRxiv - Molecular Biology 2023Quote: ... We purchased custom pairs of oligos (Sigma) that can be annealed to form double stranded DNA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: 9-phenanthrol (9-Phe) was obtained from Sigma-Aldrich (Buchs SG, Switzerland). Compounds CBA ...
-
bioRxiv - Biophysics 2020Quote: 9) Sucrose (Sigma, 84097)
-
bioRxiv - Immunology 2022Quote: ... pH 9 (Sigma-Aldrich) at a final concentration of 20mM for 30min ...
-
bioRxiv - Cell Biology 2024Quote: ... and XtremeGene-9 (Sigma) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... PC-9 (Sigma #90071810), KYSE30 (kind gift from the John Hayes Lab) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 9-aminoacridine (9-AA) and ethanol were purchased from Sigma Aldrich (Taufkirchen, Germany); 2,5-dihydroxybenzoic acid (DHB ...
-
bioRxiv - Bioengineering 2019Quote: ... rabbit anti-activated-caspase-3 (Sigma; C8487), rat anti-NKp46 (Biolegend ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-caspase-2 (clone 11B4; EMD Millipore); anti-fibrillarin (C13C3 ...
-
bioRxiv - Cell Biology 2022Quote: ... Caspase-7 (1:1000, Sigma-Aldrich, #SAB4503316), LC3 (1:5000 ...
-
bioRxiv - Immunology 2023Quote: ... caspase 1 p20 (Millipore, ABE1971, 1: 1,000), ASC (Adipogen AL177 ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer pairs for PCR were from Sigma (eGFP) and Invitrogen (GAPDH) ...
-
bioRxiv - Cell Biology 2020Quote: ... A pair of flat-ended platinum electrodes (Sigma) is held in place by a manual micromanipulator (World Precision Instruments ...
-
bioRxiv - Cell Biology 2022Quote: ... septin 9 (Sigma-Aldrich, HPA042564) and GAPDH (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: Cycloheximide (Sigma 66-81-9) was administered at a concentration of 4μM in planaria water containing a final concentration of 1.5% DMSO ...
-
bioRxiv - Cell Biology 2019Quote: ... 9-aminoacridine (A38401, Sigma Aldrich), 2-amino-5-diethylaminopentane (A48806 ...
-
bioRxiv - Biochemistry 2020Quote: ... [9] from Sigma Aldrich (#528108); Gedatolisib (PF-05212384 ...
-
bioRxiv - Neuroscience 2020Quote: ... 9-cis-Retinal (R5754, Sigma) was dissolved in Dimethyl sulfoxide (DMSO ...