Labshake search
Citations for Millipore Sigma :
1 - 50 of 92 citations for CRISPR Screening since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... CRISPR-Cas9 (Sigma #SAB4200701), RRM1 (Abcam #ab133690) ...
-
bioRxiv - Physiology 2022Quote: ... and TransIT-CRISPR (SIGMA T1706). These TransIT-CRISPR Cas9 Ribonucleotide complexes were then added dropwise to their respective iPSC plates and incubated for 48 hours before starting the initiation of the differentiation schedule.
-
bioRxiv - Molecular Biology 2019Quote: ... we employed a pre-designed lentiviral CRISPR/Cas9 vector construct ‘All in One CRISPR/Cas9 vector system (Sigma) containing guide RNA targeting human granulin ...
-
bioRxiv - Neuroscience 2021Quote: ... we used the open CRISPR design tools (Sigma) to predict the potential off-target sites which share up to 3 base mismatches with the sequence of our guide RNA ...
-
bioRxiv - Cell Biology 2020Quote: The initial screening library LOPACR1280 was purchased from Sigma. The chemicals for the follow-up studies were purchased as indicated in the table below ...
-
bioRxiv - Neuroscience 2023Quote: ... A screening layer of m-phenylenediamine (mPD, Sigma-Aldrich) was electrodeposited onto the electrode sites by immersing the electrodes in a 10 mM solution of mPD in 1x phosphate buffered saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... CRISPR Cas9 lentiviral vectors were obtained from Sigma-Aldrich and were constructed in pLV-U6g-EPCG ...
-
bioRxiv - Immunology 2020Quote: CRISPR-targeted Ramos cells were loaded with BrdU (Sigma) at final concentration of 10 μM in full RPMI at 37°C for 1 hour ...
-
bioRxiv - Cell Biology 2023Quote: ... Ribonucleoprotein complexes containing synthesized CRISPR RNA (crRNA) (Sigma-Aldrich), trans-activating crRNA (tracrRNA ...
-
bioRxiv - Microbiology 2021Quote: ... Drugs used in screening experiments were purchased from Millipore Sigma. PGP inhibitors and inducers in Figure S4 were purchased from Cayman Chemicals ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR-Lenti non-targeted control plasmid (CRISPR12-1, Sigma Aldrich) was transfected into cells to serve as a control ...
-
bioRxiv - Neuroscience 2019Quote: Synthetic SygRNA® consisting of gene specific CRISPR RNAs (crRNA) (Sigma) and transactivating RNAs (tracrRNA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the CRISPR-lenti lentiviral vector Non-directed control plasmid (Sigma-Aldrich) was used ...
-
bioRxiv - Biochemistry 2020Quote: ECM adhesion was monitored using the Millicoat™ ECM Screening Kit (Millipore). Prior to each experiment ...
-
bioRxiv - Biochemistry 2021Quote: Inhibitor screening was performed using the LOPAC-1280 compound library from Sigma and a subset of the Enamine discovery diversity set from Enamine ...
-
bioRxiv - Microbiology 2022Quote: ... Oligonucleotides used for gene cloning or screening purposes were purchased from Sigma and their sequences are listed in the S3 Table ...
-
bioRxiv - Physiology 2022Quote: ... Supplemental Figure 2A) were created using the CRISPR Design Tool (SIGMA VC40007) with the assistance of the SIGMA Bioinformatics Support Team ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR targeting sequences for ACC1 (F: GGCTTGCACCTAGTAAAGCA, R: TGCTTTACTAGGTGCAAGCC) obtained from Sigma were cloned into the pSpCas9(BB)-2A-GFP bacterial plasmid sourced from Addgene (PX458 ...
-
bioRxiv - Cancer Biology 2024Quote: ... obtained from the human CRISPR Library (Sigma-Aldrich, St Louis, MO, USA). Transduced cells were selected with puromycin ...
-
bioRxiv - Molecular Biology 2020Quote: ... For screening with the commercially available anti-calcium channel β2 antibody (Sigma-Aldrich) the filters were incubated overnight at 4°C TBS (150 mM NaCl ...
-
bioRxiv - Neuroscience 2022Quote: Drugs for tadpole screening were purchased from Sigma-Aldrich (St. Louis, MO, USA) or MedChem Express (Monmouth Junction ...
-
bioRxiv - Cell Biology 2023Quote: Mutagenesis & Genetic Screening: Animals are mutagenized using 70 mM ethyl methanesulfonate (EMS, Sigma) at 20 °C for 4 h ...
-
bioRxiv - Immunology 2021Quote: ... Lenti CRISPR universal non-target plasmid was used as a control (Sigma Aldrich). WT or Relb-/- immortalized MEFs were then transduced with lentivirus and transduced cells were FACS sorted and further selected using puromycin ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA targeting Wdfy3 was selected from the murine Sanger lentiviral CRISPR library (Sigma) and the Wdfy3-targeting lentiviral vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable CRISPR cell lines were selected with 2μg/ml puromycin (Sigma-Aldrich P9620) and 20μg/ml Blasticidin (Invitrogen R21001 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CRISPR-Cas9 with a GFP reporter (Sigma Cat# CMV-CAS9-2A-GFP), and flow sorted based on expression of GFP and BFP reporters and absence of CD81/Cd81 ...
-
bioRxiv - Microbiology 2019Quote: ... and CRISPR negative controls were purchased from Sigma (Sigma-Aldrich; St Louis, MO). The CRISPR system consisted of 3 gRNA sequences (CCACCTGAAGTTGACTCAGGTA ...
-
bioRxiv - Cell Biology 2021Quote: ... GuideRNA sequences were obtained from CRISPR-knockout library against MIA3 from Sigma-Aldrich. RPE-1 cells were transfected following the manufacturer’s protocol using TrueCut™ Cas9 Protein v2 and 30 pmol gRNA duplex targeting the SH3-domain in TANGO1L (guide L1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... CRISPR-Cas constructs U6-gRNA:CMV-eCas9-2a-tRFP (p05 transfection plasmid, Sigma-Aldrich) targeting human SLUG exon2 (target sequence ...
-
bioRxiv - Genetics 2019Quote: ... The second round of screening was performed on CYE plates containing 1% galactose (Sigma). The recA1 mutant (named RA1 ...
-
bioRxiv - Microbiology 2020Quote: ... The second round of screening was performed on CYE plates containing 1% galactose (Sigma). The imuA mutant (named IA ...
-
bioRxiv - Genetics 2021Quote: ... 1.5 ul of CRISPR solution containing 1 ug/ul of Cas9 (Sigma, or IDT) premixed with 10 mM two-piece guide RNA (crRNA and tracrRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-CRISPR/Cas9 C-terminal mouse monoclonal antibody (SAB4200751; Sigma-Aldrich, St. Louis, MO) and ProSignal Dura ECL Reagent (Genesee Scientific ...
-
bioRxiv - Bioengineering 2021Quote: High-throughput screening was performed using a custom compound collection assembled from commercial sources (Sigma, Selleck ...
-
bioRxiv - Biochemistry 2021Quote: High-throughput screening was performed using a custom compound collection assembled from commercial sources (Sigma, Selleck ...
-
bioRxiv - Cancer Biology 2022Quote: ... Myc-CaP cells were transfected with pCas9-Rb1-CRISPR plasmid (Sigma-Aldrich, St. Louis, MO) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 1 ul of CRISPR solution containing 1 ug/ul of Cas9 (Sigma or IDT) premixed with 10 mM two-piece guide RNA (crRNA and tracrRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... OC cells were transfected with lentivirus based CRISPR plasmid (MISSION® gRNA, HSPD0000035812, Sigma Aldrich) targeting human RelA gene (sgRNA sequence ...
-
bioRxiv - Microbiology 2024Quote: ... The synthetic CRISPR array was inserted into the second MCS of pACYCDuet-1 vector (Novagen). All the three vectors were co-transformed into E ...
-
bioRxiv - Developmental Biology 2022Quote: ... Screening and live imaging of embryos and larvae were performed after anaesthesia using 0.02% tricain (Sigma) The following zebrafish lines were used in this study ...
-
bioRxiv - Microbiology 2022Quote: The screening of cellulase-producing fungi was undertaken on carboxymethyl cellulose plates (CMC, 1 %; Sigma Aldrich, USA) as the sole carbon source ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... DHFR activity and screening of DHFR inhibitors testing was examined using the Dihydrofolate Reductase Assay Kit (Sigma). The assay is based on the ability of DHFR to catalyze the reversible nicotinamide adenine dinucleotide phosphate (NADPH ...
-
bioRxiv - Plant Biology 2020Quote: ... Genotyping of CRISPR/Cas9-based mutations and T-DNA insertions were performed using KAPA-Taq (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... spCas9 expression in inducible CRISPR/ Cas9 cell lines was induced with 1 μg/ml doxycycline hyclate (Sigma) at 24 hr intervals for 2 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10-15-Cas9 cells were infected with pooled CRISPR library virus using polybrene (8 µg/ml, Sigma) using a low multiplicity of infection (MOI = 0.75 ...
-
bioRxiv - Microbiology 2024Quote: ... or a non-target negative control gRNA (Human Sanger Arrayed Whole Genome Lentiviral CRISPR library, Sigma-Aldrich) using polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2022Quote: ... Gene ID: 19699) was used for the design and screening of zinc finger nuclease (ZFN) pairs (Sigma-Aldrich). Linearized plasmids carrying cDNA encoding ZNF1 or ZNF2 were subjected to reverse transcription as described [51] ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was isolated from CRISPR-edited and control cells using a GenElute Mammalian DNA Miniprep Kit (Sigma) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The gRAMP gene and the synthetic CRISPR gene were cloned into the pRSFDuet-1 vector (Novagen, kanamycin resistance), in which an N-terminal hexahistidine tag was fused with gRAMP ...