Labshake search
Citations for Millipore Sigma :
1 - 50 of 3549 citations for CD19 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: Human embryonic kidney 293 cells (HEK293) (Sigma), HEK293T (TakaraBio) ...
-
bioRxiv - Cell Biology 2021Quote: ... a Goat Anti-human Fc HRP (Sigma) was used as secondary antibody with 1:6000 dilutions ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 (Human Embryonic Kidney, ECACC 96121229 from Sigma-Aldrich Chemie GmbH) were cultured in DMEM (Dulbecco’s modified Eagle’s medium PAN biotech ...
-
bioRxiv - Microbiology 2020Quote: ... HRP-conjugated goat anti-human IgG Fc (Sigma-Aldrich) was used for detection ...
-
bioRxiv - Microbiology 2020Quote: ... anti-human Fc-conjugated to alkaline phosphatase (A9544, Sigma) was added (50 µl/well ...
-
SIMON, an automated machine learning system reveals immune signatures of influenza vaccine responsesbioRxiv - Immunology 2019Quote: ... supplemented with 10% FCS and human serum AB (Sigma) for 2 days at 107 cells/ml in 24-well plate following “RESTORE” protocol (67 ...
-
bioRxiv - Immunology 2020Quote: ... goat anti-human IgG (Fc) peroxidase conjugate (Sigma A0170) for 45 min ...
-
bioRxiv - Immunology 2021Quote: ... using an anti-human Fc mAb (Sigma-Aldrich, I6260) as capture ...
-
bioRxiv - Microbiology 2022Quote: ... and HEK293-ACE2 cells [HEK293 cells (ATCC CRL-1573) stably expressing human ACE2]22 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... Goat anti-human IgG secondary antibody-Peroxidase (Fc-specific, Sigma) prepared at 1:3000 in PBST was then added and plates were incubated for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... plates were coated with anti–human Fc (Sigma, Catalog # FAB3700259) and goat anti–human HRP–conjugated IgG (H+L ...
-
bioRxiv - Immunology 2023Quote: ... FCS was replaced with 5% human serum (Sigma-Aldrich, H6914). Hypersalinity (high NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 ug/ml of Ephrin-A5/Fc (chimera human, Sigma, E0628) and 10 ug/ml of Fc are mixed with 2.5 ug/ ml of Anti-human IgG (Fc specific ...
-
bioRxiv - Biochemistry 2022Quote: ... the secondary antibody HRP anti-Human IgG (Fc specific) (Sigma-Aldrich) was added (1:15,000) ...
-
bioRxiv - Biochemistry 2020Quote: ... HRP-conjugated anti-human Fc antibody (1:10000 dilution, Sigma Aldrich) was used ...
-
bioRxiv - Bioengineering 2023Quote: ... 100μL of ALP-conjugated anti-human IgG Fc-ALP (Sigma-Aldrich) diluted 1:5000 in M-PBST was added and incubating for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultured human embryonic kidney 293 (HEK293) cells were transfected using 2 μg/μl polyethylenimine (Sigma-Aldrich) with indicated plasmids for the expression of either Flag-KCTDs alone or in combination with Flag-Cav2.3 ...
-
bioRxiv - Neuroscience 2019Quote: ... and PAK/cofilin mechanism experiments used human embryonic kidney cells (HEK293) cultured in DMEM:F12 (Sigma, D6421) supplemented with 10% foetal bovine serum (ClonTech ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10 ug/ml of Fc are mixed with 2.5 ug/ ml of Anti-human IgG (Fc specific) FITC (Sigma, F9512) and Anti-human IgG (Fc specific ...
-
bioRxiv - Biochemistry 2022Quote: ... horseradish peroxidase (HRP)-conjugated anti-human IgG Fc specific antibody (Sigma, USA) was added at the dilution of 1:2,000 and incubated at 37 °C for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... with goat anti-human Fc-specific IgG (Sigma-Aldrich – Saint Louis, MO) immobilized with a target capture level of ~70 RU ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). After blocking ...
-
bioRxiv - Immunology 2022Quote: ... blocking of Fc receptors with human Ig (Sigma-Aldrich, St. Louis, MO); surface staining with mouse anti-human CD3-APC-H7 ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). For analysis of neutrophil activation ...
-
bioRxiv - Bioengineering 2024Quote: ... or horseradish peroxidase-conjugated goat anti-human IgG Fc antibody (Sigma, A0170) diluted 1:20,000 in the blocking buffer for an hour at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... harvested neutrophils were resupended in PBS + 2% FCS and Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). Cells were stained with CD15-APCCy7 (1:100 ...
-
bioRxiv - Immunology 2023Quote: ... harvested neutrophils were resupended in PBS containing 2% FCS and Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). Cells were stained with the following antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... ephrinB1-Fc (R&D, #473-EB) or ephrinB2-Fc (R&D, #496-EB) were pre-clustered using goat anti-human Fc IgG (Sigma, #I2136) in 4:1 ratio for 30min.
-
bioRxiv - Biochemistry 2021Quote: HEK293 cells (Sigma:85120602) were cultured using DMEM (Gibco™ ...
-
bioRxiv - Biophysics 2023Quote: HEK293 cells (Sigma Aldrich) and were cultured in DMEM (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in which the plate was coated with anti–human Fc (Sigma, Catalog # FAB3700259), and after overnight incubation at 4°C ...
-
bioRxiv - Bioengineering 2021Quote: ... The binding of VHH-Fcs/ACE2-Fc to S1 was detected using 100 µL 1 µg/mL HRP-conjugated goat anti-human IgG (Sigma, Cat#A0170). Finally ...
-
bioRxiv - Bioengineering 2021Quote: ... plates were washed 10 times with PBST and the ACE2-Fc binding was detected using 1 µg/mL goat anti-human IgG (Fc specific) HRP conjugate antibody (Sigma, Cat#A0170) in 100 µL PBSCT ...
-
bioRxiv - Neuroscience 2021Quote: Human embryonic kidney (HEK293) cells were maintained in a 37°C/5% CO2 atmosphere in DMEM:F12 (Sigma, D6421) supplemented with 10% foetal bovine serum (ClonTech ...
-
bioRxiv - Neuroscience 2021Quote: ... MaxiSorp plates (Thermo) were coated with 100µl of goat anti-human Fc antibody (Sigma) diluted 1:500 in PBS overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Plates were washed before detection and goat anti-human Fc-HRP conjugated antibody (Sigma) (1:5000 dilution in PBS ...
-
bioRxiv - Neuroscience 2020Quote: MaxiSorp plates were coated with 100 µl of goat anti-human Fc antibody (Sigma) diluted 1:500 in PBS or 3 mg/ml of an anti-VNAR antibody (courtesy of Martin Flajnik ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μg/mL goat anti-human IgG1 Fc F(ab’)2 (Sigma-Aldrich, I3391) was coated in 96-well NUNC Immunoplate (Thermo Fisher ...
-
bioRxiv - Physiology 2023Quote: Rm-EphrinA4/Fc chimera (R&D) was clustered with anti-human Cy3 antibody (Sigma) diluted 1 ...
-
bioRxiv - Cancer Biology 2022Quote: Expression of CD19 (FMC63-PE, Millipore) and CD20 (CD20-PE ...
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Biochemistry 2021Quote: HEK293 and HEK293T cells (Sigma) were cultured at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: The human embryonic kidney cell lines HEK293 and HEK293T were cultured in Dulbecco’s modified Eagle’s medium (D1152, Sigma-Aldrich) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2023Quote: U2OS osteosarcoma cells and HEK293 (human embryonic kidney) cells were grown in DMEM (Dulbecco’s Modified Eagle’s Medium; Sigma, D1152) supplemented with 10% fetal bovine serum (FCS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and anti-Human IgG (Fc specific) −Peroxidase antibody produced in goat was from Sigma-Aldrich. Two TNFα-antagonists were purchased ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL of goat anti-human IgG (Fc specific)-Peroxidase antibody (1 : 5000 dilution, Sigma) was added and incubated for another 1 h at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... The anti-human Fc capturing mAb (GG-7) was from Sigma-Aldrich (St. Louis, MO). LIBS-2 was purchased from EMD Millipore (Billerica ...
-
bioRxiv - Bioengineering 2023Quote: ... 100 µL of anti-human IgG (Fc specific)-peroxidase antibody produced in goat (Sigma, A0170) was added to each sample in a 1:40,000 dilution of PBS and incubated for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... Binding of VHH-Fcs or conventional human monoclonal antibodies was detected by HRP-conjugated rabbit anti-human IgG (Sigma, A8792, 1/2000). After washing 50 μL of TMB substrate (Tetramethylbenzidine ...