Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for BD 2 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 2% normal mouse serum (Sigma), 10% normal donkey or goat serum ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Centrin-2 (20H5, Millipore). Secondary antibodies were donkey anti-rabbit conjugated to Alexa 594 (Abcam ...
-
bioRxiv - Bioengineering 2021Quote: ... A 1 : 2 mixture of elastase (BD Millipore) and saline was injected into the RCCA while maintaining the aneurys clip secured ...
-
bioRxiv - Microbiology 2021Quote: ... with 2% w/v Noble Agar (BD, Sigma). Prior to use ...
-
bioRxiv - Neuroscience 2022Quote: ... (2) mouse monoclonal anti-parvalbumin 2000X (Millipore), 48 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-MAP2 (Mouse, HM-2, Sigma, M4403), Anti-GAPDH (Mouse ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-MPM-2 (1:100; Millipore), rabbit anti-GAF (1:1000) ...
-
bioRxiv - Immunology 2022Quote: ... and 2% normal mouse serum (Sigma Aldrich) prior to surface staining ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 ng/mL mouse GDNF (Sigma-Aldrich), 4 ng/mL human NT-3 (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... and 2% normal mouse serum (Sigma, #M5905) (CXCR5 staining buffer) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-pERK1/2 (T185/Y187) and mouse anti-Flag M2 (Sigma); and mouse anti-H3 and rabbit anti-H3K4 trimethyl (Active Motif).
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Tubulin (B-5-1-2, Sigma), mouse anti-CHC (X22 ...
-
bioRxiv - Cell Biology 2020Quote: ... or mouse anti-Centrin 2 (clone 20H5; Sigma), and centromeres using 1:500 human anti-centromere antibodies (ACA ...
-
bioRxiv - Cell Biology 2022Quote: ... blebbistatin (Sigma, B0560, 2 mg/kg per mouse) 1 hour before mechanical force application ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-diphospho-ERK1/2 (Sigma Aldrich, M8159), mouse anti-MMP1 (DSHB ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti- PACSIN 2 (SAB1402538-100UG, SIGMA), rabbit polyclonal anti-PACSIN3 (AB37612 ...
-
bioRxiv - Cell Biology 2023Quote: ... α-actinin-2 (mouse monoclonal, A7811, Sigma, 1:200), and VDAC1 (rabbit polyclonal ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-actin (mouse, Sigma-Aldrich AB_476730, Substrate 1:2); anti-Cnn (rabbit ...
-
bioRxiv - Biophysics 2021Quote: ... 1% mouse anti-MAP2 (MS X MAP-2, Millipore) and 0.1% rabbit anti-GFAP (GFAP-Rb-Af800 ...
-
bioRxiv - Biochemistry 2021Quote: ... or 2 μg of mouse IgG control antibody (Sigma) in a rotating platform at 4 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-CMV IE1/2 monoclonal antibody (MAB8131, Millipore), and rabbit anti-ZAP polyclonal antibody (PA5-31650 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse anti-centrin 2 (Millipore, 04-1624 20H5). For anti-γtubulin only ...
-
bioRxiv - Immunology 2021Quote: ... Mouse chow diets containing 2% Cholestyramine (CME) (Sigma-Aldrich) or 0.2% Cholic Acid (CA ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-tubulin (B-5-1-2; Sigma-Aldrich), and mouse anti-GAPDH (MCA4739 ...
-
bioRxiv - Neuroscience 2023Quote: ... (2) mouse monoclonal antibody to HCN1 obtained from Millipore-Sigma (catalog# SAB5200024 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3) mouse IgG2a anti-GluA2 (Millipore, 1:2 000) and secondary antibodies AlexaFluor 647 donkey anti-rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... and BrdU (2 mg/mouse, Sigma-Aldrich, B5002-100MG) were subsequently administrated via tail vein injections (2h apart) ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse α-tubulin (clone B-5-1-2, Sigma); rabbit α-Histone H3 (ab1971 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-microtubule-associated protein 2 (Map2, 1:250, Sigma), rabbit anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1:100 MPM-2 mouse monoclonal (EMD Millipore #05-368), 1:200 anti-nuclear pore antibody Mab414 (Abcam ab24609) ...
-
bioRxiv - Biophysics 2020Quote: ... Mouse anti-α-tubulin (B-5-1-2) (T5168; Sigma), Mouse anti polyglutamylated tubulin ...
-
bioRxiv - Plant Biology 2020Quote: ... for 2 h followed by Anti-Mouse-HRP (Sigma-Aldrich) (1/5,000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1-2 uL of mouse anti-FLAG (M2, F3165 Sigma) antibody was used ...
-
bioRxiv - Cell Biology 2020Quote: ... and 12ng/mL Fgf-2 from mouse (Sigma-Aldrich SRP3038). mESCs were passaged using Accutase (STEMCELL Technologies 07920 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-alpha-tubulin B-5-1-2 (Sigma, T5168), mouse anti-alpha-tubulin TAT-1 (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiment 2 – mouse anti-FLAG (Sigma, 1:2000, F1804 RRID:AB_262044) and rabbit anti-GluA1 (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Centrin-2 (1:500, Sigma Aldrich, 04-1624), rabbit anti-CEP164 (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti Centrin-2 (1:1000, Sigma Aldrich 04-1624), mouse anti γ-tubulin (GTU88 ...
-
REV-ERBα mediates complement expression and circadian regulation of microglial synaptic phagocytosisbioRxiv - Neuroscience 2020Quote: ... 2% Mouse-on-mouse (M.O.M) blocking reagent and 0.4% Triton X-100 (Sigma-Aldrich, St. Louis, MO). Sections were then incubated in TBS containing 10% goat (or donkey ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Genomics 2020Quote: ... mouse monoclonal anti-HMGB1/2 (1:1000; Sigma-Aldrich 12248-3D2); rabbit polyclonal anti-CTCF (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse Tubulin (clone B-5-1-2 from Sigma, 1:5000), rabbit ZW10 (ab21582 from abcam ...
-
bioRxiv - Pathology 2019Quote: ... Mouse anti-NCAM Clone 2-2b (Millipore MAB5324, RRID:AB_95211, 1:250); Rabbit anti-OCT-4 (Cell Signaling Technology 2750 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 12 ng/mL Fgf-2 from mouse (Sigma-Aldrich SRP3038). mESCs were passaged using StemProTM AccutaseTM (Thermo Fisher Scientific A1110501 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-His antibody (Sigma; 1:5,000 in PBS + 2% BSA) was added and incubated for 1h ...
-
bioRxiv - Genomics 2023Quote: ... mouse α-tubulin (1:10,000, B-5-1-2, Sigma Aldrich). Secondary HRP-conjugated antibodies (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies (rat anti-BrdU, 1:100, Abcam; mouse anti-BrdU, 1:100,BD Biosciences; mouse anti-Nestin, 1:300, Millipore; rabbit anti-GFAP ...
-
bioRxiv - Genetics 2020Quote: ... Specific primers for mouse leptin and 2 mouse housekeeping genes used for normalization (β-actin and 34B4 mouse genes) were purchased from Sigma (Sigma, France). We used primers for Leptin (forward ...
-
bioRxiv - Biochemistry 2022Quote: ... also contained 1-2 µg/uL α-MBPAF546 or 1-2 µg/uL mouse α-BRCA2 (Ab1, Millipore) plus 1-2 µg/µL goat α-mouse IgGAF546 (Molecular Probes).
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...