Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Adenovirus Type 5 Particles CMV GFP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and CRISPR-Cas9 with a GFP reporter (Sigma Cat# CMV-CAS9-2A-GFP), and flow sorted based on expression of GFP and BFP reporters and absence of CD81/Cd81 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO.1-puro-CMV-tGFP plasmids targeting SNX5 (5’-ACTATTACAATAGGATCAAAG-3’, 5’-CTGAGTATCTCGCTGTGTTTA-3’) and SNX6 (5’-AGTAAAGGATGTAGATGATTT-3’, 5’-GCCGAAACTTCCCAACAATTA-3’) (Sigma-Aldrich) were lentivirally transduced ...
-
bioRxiv - Microbiology 2023Quote: ... and porcine mucin type II (5, Sigma; pretests of the strains grown in WC medium showed no difference between the beads supplemented with type II and type III mucins) ...
-
bioRxiv - Genetics 2023Quote: ... TRC2-pLKO.5-puro-CMV-TurboGFP plasmid was used (SHC 203; Sigma-Aldrich). HEK293T cells were plated at 1 x105 cells per well of a 6 well plate and transfected with 1 µg of TRC2-pLK0.1 plasmid ...
-
bioRxiv - Cell Biology 2019Quote: ... Day 5 moDCs were stimulated with zymosan particles (Z4250, Sigma-Aldrich) for 5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Particles were then functionalized with 5 mg/mL BSA (Sigma, A3059) or streptavidin (Neuromics ...
-
bioRxiv - Microbiology 2022Quote: ... pFlag-CMV (Sigma), pEGFP-C1 (Clontech ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mg of ConA (Type IV, Sigma Aldrich) was dissolved in 5mL PBS at pH6.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... Transduction was carried out using CMV-GFP lentiviruses in growth media with 8 μg/ml polybrene (Sigma-Aldrich) for 3-4 hours.
-
bioRxiv - Genomics 2021Quote: ... The guide RNA and Cas9 were cloned into the vector U6-gRNA/CMV-Cas9-GFP (Millipore Sigma, USA) and each pair of guides were transfected at 10μg into 72 wells of low-density (∼10,000 cells ...
-
bioRxiv - Genetics 2020Quote: ... wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich). For co-immunoprecipitation ...
-
bioRxiv - Developmental Biology 2021Quote: ... equilibrated into 5% gelatin (300-bloom, type-A, Sigma), and sectioned on a Vibratome 1500 (Harvard Apparatus) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 mg of Concanavalin A (Type IV, Sigma Aldrich) was dissolved in 5mL PBS at pH6.5 ...
-
bioRxiv - Immunology 2020Quote: ... and protease type XXIV (5 mg/ml; Sigma-Aldrich) for 15 min and agitation in protease-free solution for another 35 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 – 5 mg/mL collagenase type II (Sigma-Aldrich), 1:500 Primocin and 10 µM Y-27632 (Cayman Chemicals ...
-
bioRxiv - Cancer Biology 2019Quote: A ZIC-pHILIC 150 × 2.1 mm (5 µm particle size) column (EMD Millipore) was employed on a Vanquish Horizon UHPLC system for compound separation at 40 °C ...
-
bioRxiv - Cancer Biology 2021Quote: A ZIC-pHILIC 150 × 2.1 mm (5 µm particle size) column (EMD Millipore) was employed on a Vanquish Horizon UHPLC system for compound separation at 40°C ...
-
bioRxiv - Biochemistry 2020Quote: ... myoblasts were transfected at 60% confluency with DNA constructs expressing CMV-Cas9(D10A) and paired U6-gRNAs (5’-GTTGTTGCTGTCTTTCCCCAGG and 5’- ACCCCCGCTTCAACGCCCATGG) (Sigma Aldrich) using TransIT-X2 reagent (Mirus Bio) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cytosolic expression of GFP or tdTomato was achieved by transduction with plKO.1-puro-CMV-TurboGFP (SHC003, Sigma- Aldrich, USA) or cytoplasmic tdTomato (LeGo-T2 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AGTTTCTCTGTCCGATTTAAA-3’] are in the plasmid backbone pLKO.1-CMV-tGFP and were from Sigma Millipore (St Louis ...
-
bioRxiv - Cell Biology 2022Quote: ... DS contained 5% collagenase type I (Sigma-Aldrich; 5mg/ml), 19% of PBS and 1% of fetal bovine serum (FBS) ...
-
bioRxiv - Developmental Biology 2021Quote: p3x-FLAG-CMV-10 (Sigma) was used for the generation of PAX6 and PAX6(5A ...
-
bioRxiv - Cell Biology 2021Quote: ... pFLAG-CMV-6b (SIGMA-ALDRICH) was digested with HindIII ...
-
bioRxiv - Cancer Biology 2023Quote: ... pSF-CMV-VSVG (Sigma-Aldrich) and either pCDH-EF1-copGFP-T2A-Puro for GFP fluorescence or pCDH-EF1-copGFP-T2A-Puro for mCherry fluorescence ...
-
bioRxiv - Microbiology 2022Quote: ... Metabolite sample (5 μL) was injected onto a ZIC-pHILIC 2.1 × 150 mm (5 μm particle size) column (EMD Millipore). Buffer A was 20 mM ammonium carbonate ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant (5 μl) was injected onto a ZIC-pHILIC 150 × 2.1 mm (5-μm particle size) column (EMD Millipore) connected to a Thermo Vanquish ultrahigh-pressure liquid chromatography (UPLC ...
-
bioRxiv - Systems Biology 2020Quote: ... and then treated with 5 mg/ml collagenase type I (Millipore) for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were kindly gifted by Dr Simon Langdon (University of Edinburgh, Edinburgh, UK) and labelled with GFP (pLKO.1-Neo-CMV-tGFP vector from Sigma-Aldrich, USA) to enable their identification within the 3D organotypic model ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: SiO2 particles with diameters of approximately 1-5 μm were purchased from Sigma-Aldrich (USA). Primary antibodies against METTL3 ...
-
bioRxiv - Cell Biology 2020Quote: ... were incubated with 100 μL pseudotyped particles of each type, together with 50 μM hydroxychloroquine sulfate (HCQ, Cayman, #17911) or 50 μM tetracaine hydrochloride (Sigma-Aldrich, #T7508) for 1 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... They were then embedded in 5% agarose (type IX-A; Sigma-Aldrich) and 20% sucrose in PBS ...
-
bioRxiv - Pathology 2023Quote: Silica particles (Sigma Aldrich, St ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... zymosan particles (Sigma Aldrich), 25 uM nigericin (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... PCR was performed to add the 3XFlag tag to the N terminus of ZBP1 cDNA at the 5’ Not1 site and 3’ Sal1 site to facilitate cloning into expressing vector p3XFlag-CMV-7.1 (Sigma). The resulting plasmid containing the 3XFlag-ZBP1 was further subcloned in the Bst1 and BamHI sites of the vector pLVX-EF1α-AcGFP1-C1 (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... The chamber was incubated for 5 mins in 0.1 mg·mL−1 anti-GFP (clone GFP-20, Sigma-Aldrich) diluted with motility buffer (MB ...
-
bioRxiv - Immunology 2020Quote: ... a CMV peptide pool and PHA (Sigma) were included as controls ...
-
bioRxiv - Molecular Biology 2021Quote: ... or p3xFLAG-Myc-CMV-24 (Sigma-Aldrich). Competent JM109 Escherichia coli cells (Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... and p3×FLAG-CMV-14 (Sigma-Aldrich). Other plasmids used in this study ...
-
bioRxiv - Immunology 2022Quote: ... media was replenished with RPMI containing 5% type AB human serum (Sigma-Aldrich). For single-round experiments with VSV-G-pseudotyped viruses ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 mg/mL (adult) or 2mg/mL (fetal) Collagenase Type II (Sigma). The digestion mixture was strained (70 μM) ...
-
bioRxiv - Neuroscience 2022Quote: ... A Sequant ZIC-pHILIC column (2.1 mm i.d. × 150 mm, particle size of 5 μm, Millipore Sigma) was used for separation ...
-
bioRxiv - Systems Biology 2021Quote: ... Lentiviral particles were harvested 72 hours later by passing media supernatant through a 5 μm filter (Millipore) and concentrating using a 100-kDa Amicon filter (Millipore) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sample was injected onto a ZIC-pHILIC 2.1 × 150 mm (5 µm particle size) column (EMD Millipore). Buffer A was 20 mM ammonium carbonate ...
-
bioRxiv - Neuroscience 2023Quote: ... A Sequant ZIC-pHILIC column (2.1 mm i.d. × 150 mm, particle size of 5 µm, Millipore Sigma) was used for separation ...
-
bioRxiv - Cell Biology 2022Quote: ... A Sequant ZIC-pHILIC column (2.1 mm i.d. × 150 mm, particle size of 5 μm, Millipore Sigma) was used for separation of metabolites ...
-
bioRxiv - Molecular Biology 2023Quote: ... A Sequant ZIC-pHILIC column (2.1 mm i.d. × 150 mm, particle size of 5 µm, Millipore Sigma) was used for separation ...
-
bioRxiv - Immunology 2024Quote: ... and FLUC (firefly luciferase) was amplified from pTrip-CMV-FLUC-EYFP (72) and cloned into p3xFLAG-CMV-10 (Sigma) NotI/XbaI ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with U6-gDNA (5’-AAAGACGTCCCTAACAAGT-3’; clone ID es: HSPD0000063884): CMV-eCas9-2a-tGFP (Sigma-Aldrich). 48h after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/ml [GIBCO], Dispase 5 mg/ml [GIBCO], Y-27632 10.5 µM [Sigma] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO], Dispase 5 mg/mL [GIBCO], Y-27632 10.5 μM [Sigma] ...