Labshake search
Citations for Millipore Sigma :
1 - 50 of 1880 citations for 2x SYBR Green qPCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... KAPA SYBR® Fast qPCR Master Mix (2x) Kit (Sigma), was used ...
-
bioRxiv - Immunology 2024Quote: ... KAPA SYBR FAST qPCR Master Mix (2X) (Millipore Sigma; KK4600) and a QuantStudio 7 Pro qPCR (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... 2X Luminoct SYBR Green qPCR ready mix (Sigma-Aldrich, Dorset, UK), 25ng of cDNA and PCR grade water (Roche ...
-
bioRxiv - Genetics 2022Quote: ... and KAPA SYBR FAST qPCR Master Mix (2X) Kit (Sigma-Aldrich, USA). RT-qPCR primers for the FLO1 gene were 5′-CGCCGATCACATCAACGAACT-3′ and 5′-ACCCCATGGCTTGATACCGTC-3′ ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCR reactions were performed using SYBR Green Master Mix (Sigma L6544) and primers for pyruvate carboxylase (Forward ...
-
bioRxiv - Genetics 2024Quote: ... RT-qPCR was performed using KAPA SYBR® FAST qPCR Master Mix (2X) Universal (Sigma-Aldrich) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... qPCR assays were performed using FastStart Universal SYBR Green Master mix (Sigma) according to the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Microbiology 2021Quote: ... A PCR master mix was prepared using 10 µL KAPA SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich, Gillingham, UK), 0.4 µL ROX High ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-Time qPCR was performed using the Fast SYBR Green Master Mix (Sigma) in a QuantStudio 5 Real-Time-PCR-Cycler (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 10 μl of KAPA SYBR FAST qPCR Master Mix (2X) ABI Prism (Sigma-Aldrich), which contains a Taq DNA polymerase that lacks proofreading activity ...
-
bioRxiv - Systems Biology 2020Quote: RT-qPCR was carried out using FastStart Universal SYBR Green Master Mix (Rox) (Sigma Aldrich) in an Applied Biosystems QuantStudio 6 ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR mixtures (10 μL) contained 5 μL Kapa SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich), 300 nM of the primer pair ...
-
bioRxiv - Biochemistry 2022Quote: ... and FastStart Universal SYBR Green QPCR Master (Rox) (Sigma) using Roche LightCycler 480 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and FastStart Universal SYBR Green QPCR Master (Rox) (Sigma) using Roche LightCycler 480 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μL 1 μM primer (equal mix of Forward and Reverse primers; Table S2) and 5 μL 2x SYBR Green master mix (Sigma) in a 384-well plate using a Roche LightCycler 480 with the following parameters ...
-
bioRxiv - Genetics 2023Quote: ... and SYBR green master mix kit (Sigma, Aldrich, Germany) respectively according to the manufacturer’s instructions ...
-
STAT3 protects HSCs from intrinsic interferon signaling and loss of long-term blood-forming activitybioRxiv - Immunology 2023Quote: ... using 2X SYBR Select Master Mix (Sigma-Aldrich, St. Louis, MO) and gene-specific primers (Table S5) ...
-
bioRxiv - Genomics 2021Quote: ... qPCR was performed using KAPA SYBR® FAST qPCR Master Mix (Sigma Aldrich) and run on the C1000 Touch™ thermal cycler (BIO-RAD ...
-
bioRxiv - Physiology 2021Quote: ... FastStart Universal SYBR Green Master Mix (4913850001) was from Millipore-Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified using KiCqStart SYBR Green qPCR Ready Mix (Sigma Aldrich) on a Step-One Real-Time PCR instrument as above ...
-
bioRxiv - Immunology 2021Quote: ... was performed in QuantStudio 5 384 Optical well plate system (Applied Biosystem) in a standard 10 ul with the 2X SYBR FAST qPCR Master Mix (Sigma-Aldrich) with gene specific primers (Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were amplified using FastStart Universal SYBR Green QPCR Master (Rox) (Sigma), DNA-specific primer pair ...
-
bioRxiv - Genomics 2023Quote: ... RT-qPCR was performed using FastStart Universal SYBR Green Master (Sigma-Aldrich) and primers are given in Supplementary Table 9.
-
bioRxiv - Genetics 2019Quote: Quantitative amplification was performed according to manufacturer’s specifications using KAPA SYBR® FAST qPCR Kit Master Mix (2X) Universal (Sigma, cat. #07959397001). 12 separate RNA isolations were analyzed ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Real-Time PCR reactions were performed in 20 µL mixtures containing 10 µL KAPA SYBR FAST qPCR Master Mix (2X) (Sigma-Aldrich, KK4605), 200 nM final concentration of species-specific rpoD forward and reverse primer and up to 3 µL of sample template ...
-
bioRxiv - Cell Biology 2024Quote: ... using the KAPA SYBR® FAST qPCR Master Mix (2×) Kit (Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Diluted cDNA was amplified by PCR using the Sybr Green Master Mix (Sigma), and raw threshold-cycle time (Ct ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 µL of the Roche FastStart Universal SYBR Green Master mix (Millipore Sigma) was mixed with cDNA and primers to achieve the final concentrations of 100 ng/µl and 400 nM ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed using FastStart Universal SYBR Green Master Mix (Sigma, 4913850001). The aggregates of three housekeeping genes (B2m ...
-
bioRxiv - Molecular Biology 2024Quote: ... to generate cDNA and performed qPCR using FastStart Universal SYBR Green Master (Sigma Aldrich). We used primers against Citrine (CGGCGACGTAAACGGCCACAAGTTCAG ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR reaction mixture consisted of Kappa Probe Fast qPCR Master Mix (2X) Kit (Sigma-Aldrich), 0.75 μL of primers and 2.5 μL of RNA in a final volume of 10 μL reaction ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was performed using the KAPA SYBR FASTqPCR kit Master Mix (Sigma-Aldrich, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: RT-qPCR was performed with the SYBR Green JumpStart Taq Ready Mix (Sigma – S4438) and custom-made primers (Supplementary Table 4) ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed using the SYBR Green JumpStart Taq Ready Mix (#S4438, Sigma Aldrich) and a CFX384 RT System (Bio-Rad ...
-
bioRxiv - Plant Biology 2024Quote: ... qPCR was performed using the SYBR Green JumpStart Taq Ready Mix (#S4438, Sigma Aldrich) and a CFX384 RT System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... was added to 24 μl of reaction mix containing 12.5 μl of 2x Sybr Green Jumpstart Taq Ready-mix (Sigma Aldrich), 0.125 μl of each of the primers PRK341F and MPRK806R (Table S2) ...
-
bioRxiv - Microbiology 2020Quote: ... Cyber Green master mix (Sigma Aldrich) was used for both qPCR and nl-qPCR however there was 1.8-fold more DNA in nl-qPCR reactions ...
-
bioRxiv - Genetics 2019Quote: ... Primers for SYBR green qPCR (Sigma-Aldrich) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Physiology 2023Quote: ... KiCqStart SYBR Green qPCR ReadyMix (Sigma Aldrich), along with 300 nM forward and reverse primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by RT-qPCR with the FastStart Universal SYBR Green Master (Sigma-Aldrich, Cat No. 4913850001). Primers are listed in Supplementary Table 2 ...
-
bioRxiv - Genomics 2019Quote: ... We performed qRT-PCR using FastStart Universal SYBR Green Master Mix with ROX (Sigma, 4913914001) on a ViiA 7 Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Immunology 2022Quote: ... cDNAs were mixed with indicated gene-specific primers and SYBR green PCR Master Mix (Sigma), and qRT-PCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR system.
-
bioRxiv - Cancer Biology 2022Quote: ... using gene-specific primers (Table S2) and FastStart Universal SYBR Green master mix (Millipore-Sigma). Reactions were run in duplicate and relative Ct values were normalized and calculated independently using the –ΔΔ Ct method for the expression of the housekeeping genes HPRT1 and RPL13A (all primers are listed in Table S1).
-
bioRxiv - Cancer Biology 2022Quote: ... using gene-specific primers (Table S2) and FastStart Universal SYBR Green master mix (Millipore-Sigma). Reactions were run in duplicate and relative Ct values were normalized and calculated independently using the –ΔΔ Ct method for the expression of the housekeeping genes HPRT1 and RPL13A (all primers are listed in Table S1).
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR analysis was performed using the KAPA SYBR Fast PCR master mix (Sigma Aldrich, #KK4605) or SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was performed using PerfeCTa SYBR Green FastMix Reaction Mix (Green Fastmix, ROX™) (QuantaBio) and KiCqStart primer sets (Sigma). ELISAs were performed as per the manufacturer’s instructions (R&D Systems).
-
bioRxiv - Neuroscience 2021Quote: ... using the SYBR™ Green master mix (life technologies) and predesigned primers (KiCqStart® Primers, Sigma). Relative gene expression levels were normalized to β-actin in each sample with the ΔΔCT method.
-
bioRxiv - Microbiology 2024Quote: ... qPCR was conducted using KiCqStart SYBR qPCR Ready Mix (Sigma, KCQS01) with the 7500 Fast Dx Real-Time PCR Instrument (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... Real time RT-qPCR was performed using PerfeCTa SYBR Green FastMix Reaction Mix (Green Fastmix, ROX™) (QuantaBio) and KiCqStart primer sets (Sigma). For tissue conditioned media (TCM ...
-
bioRxiv - Immunology 2022Quote: ... Real time RT-qPCR was performed using PerfeCTa SYBR Green FastMix Reaction Mix (Green Fastmix, ROX™) (QuantaBio) and KiCqStart primer sets (Sigma).