Labshake search
Citations for Millipore Sigma :
4451 - 4500 of 10000+ citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mg/ml ascorbic acid (Sigma A4544) and 4.5 × 10-4M monothioglycerol (Sigma M-6145) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µg/mL clavulanic acid (Sigma-Aldrich), 1.5 mg/mL serine hydroxamate (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2024Quote: ... uric acid (5 mg/mL; Sigma-Aldrich) was dissolved in 0.1 M borate buffer on a stirrer hot plate ...
-
bioRxiv - Plant Biology 2024Quote: ... 5-hydroxyferulic acid (95%, Sigma-Aldrich Merck), sinapic acid (98% ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM ascorbic acid (Sigma, A-4544)) and incubated 30 min at RT protected from light ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were incubated with primary antibodies overnight at 4°C (rabbit anti-PALS-5 diluted 1:1,000 and mouse anti-tubulin (Sigma, catalog number T9026) diluted 1:3000 in blocking buffer) ...
-
bioRxiv - Bioengineering 2021Quote: ... The gel compartment was removed after 1 to 5 days of incubation (depending on fusion) by adding 4 w/v% sodium citrate (Sigma Aldrich Inc.) for 15 min as a lyase for alginate (Supplementary figure 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were then incubated with the primary antibodies in a blocking solution for 5 days at 4°C: mouse anti-GFAP (G3893, Sigma, 1:300), mouse anti-HSP70 (MA3-028 ...
-
bioRxiv - Biophysics 2020Quote: ... 20 µL of 10 % Tween® 20 and 20 µL of a potassium phosphate buffer (4:5 mixture of 1 M monobasic and dibasic potassium phosphate, Sigma Aldrich, USA) were added as well as 10 µL of a 2 nmol thiol-modified single-stranded DNA solution (5’-T20-SH-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... HCECs were grown in a hypoxia chamber with 2% O2 and 5% CO2 at 37°C in 4 parts DMEM to 1 part medium 199 (Sigma-Aldrich #M4530) with 2% cosmic calf serum (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... and proteins were eluted with 4 mL of the same buffer but containing 100 μL (5 mg mL−1) Flag peptide (Sigma-Aldrich F4799). The eluate was spin concentrated (Sigma-Aldrich CLS431485-251A ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were permeabilized for 10 minutes in 0.5% Triton X in PBS and incubated for 48 hours at 4°C in rabbit anti-NG2 (AB5320, Merck Millipore; 1:500) and rat anti-MBP (MCA409 ...
-
bioRxiv - Neuroscience 2024Quote: ... and probed with the following antibodies (diluted in 5% milk in PBST) overnight at 4 °C: α-Tubulin (1:400000, Sigma t9026), α-Dnmt3a (1:5000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... were recovered from Matrigel using 3 mM EDTA in DPBS, washed, centrifuged (200g, 5 min, 4°C) and lysed with 1x RIPA buffer supplemented with PPI (1:100, Sigma- Aldrich, 04693132001), and benzonase (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: Zona pellucida were removed from embryos with 3-4 min pronase (0.5% w/v Proteinase K, Sigma P8811 ...
-
bioRxiv - Neuroscience 2020Quote: ... mounted on slide glass or coverslips and postfixed with 4% PFA in PB or 3% glyoxal (Sigma) for 2 h at RT ...
-
bioRxiv - Bioengineering 2021Quote: ... scaffolds (n = 3) were submerged into 500 μL of 4 M guanidine hydrochloride (GuHCl, Sigma-Aldrich, Canada) buffer supplemented with a protease inhibitor (Roche Applied Science ...
-
bioRxiv - Bioengineering 2021Quote: ... 48 h and day 21 hBMMSC-seeded scaffolds (n=3) were fixed in 4% paraformaldehyde (Sigma, Canada) for 1 hour and submerged in gradient sucrose solutions from 10% to 30% ...
-
bioRxiv - Bioengineering 2022Quote: ... ADC scaffolds (n = 3) were gently agitated in 4 M guanidine hydrochloride buffer (GuHCl, Sigma-Aldrich, Canada) supplemented with a protease inhibitor (Roche Applied Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were incubated overnight at 4 °C in PBST containing 3% bovine serum albumin (BSA) (Sigma Aldrich) and primary antibodies ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were passaged at 80% confluence (approximately every 3-4 days) in T75 flasks (Millipore-Sigma, Z707546) using 0.25% Trypsin-EDTA (ThermoFisher 25200072 ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were passaged at 80% confluence (approximately every 3-4 days) in T75 flasks (Millipore-Sigma, Z707546) using 0.25% Trypsin-EDTA (ThermoFisher 25200072 ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Biochemistry 2024Quote: ... Incubation with the 4-MU substrate (3 mM in citrate phosphate buffer with 0.2% taurodeoxycholate, Sigma-Aldrich) for 90 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... were thawed at room temperature for 3-4 minutes in Nuclei EZ lysis buffer (Sigma Nuc 101) mixed with RNAase inhibitor (0.5U/µl ...
-
bioRxiv - Neuroscience 2024Quote: ... Zebrafish larvae at 4 dpf were anaesthetised using 0.016 % ethyl 3-aminobenzoate methane sulfonate (MS-222, Sigma). They were then mounted in 1% low melting point agarose (LMP ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... the 3:1-DMEM/F12-medium was supplemented with 10 μM retinoic acid (Sigma, #R2625), and the medium was daily exchanged ...
-
bioRxiv - Cell Biology 2020Quote: ... and resuspended in 100 μl of 5% 5-Sulfosalicylic acid (Sigma) solution ...
-
bioRxiv - Immunology 2024Quote: ... and resuspended in 100 μl of 5% 5-Sulfosalicylic acid (Sigma) solution ...
-
bioRxiv - Cell Biology 2023Quote: Fresh cells were lysed with 5% 5-sulfosalicylic acid (Sigma-Aldrich) solution ...
-
bioRxiv - Neuroscience 2020Quote: ... retinas were washed during 5 minutes in PBS and permeabilized overnight at 4°C in 5% normal goat serum (NGS, Sigma Aldrich) and 1% Triton-X100 in PBS ...
-
bioRxiv - Microbiology 2019Quote: ... metabolic activity by the tetrazolium salt 2,3-bis(2- methoxy-4-nitro-5-sulfophenyl)-5-(phenylamino)-carbonyl-2H-tetrazoliumhydroxidand (XTT; Sigma-Aldrich, USA) reduction assay ...
-
bioRxiv - Systems Biology 2020Quote: BALB/cJ mice were subjected to cutaneous Oxazolone (Oxa) challenge by applying 5% 4-Ethoxymethylene-2-phenyl-2-oxazolin-5-one (Sigma-Aldrich) in acetone and olive oil topical to the skin as described [74] ...
-
bioRxiv - Immunology 2022Quote: Mice were sensitized on the shaved back-skin for two consecutive days with 50 μl of 5% Oxa (4-Ethoxymethylen-2-phenyl-2-oxazolin-5-on, Sigma-Aldrich) diluted in methanol and acetone (1:1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 7×10−3 mM hypoxanthine (Sigma-Aldrich, St. Louis, MO) at RT ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: PESTANAL® analytical grade tefluthrin (2,3,5,6-tetrafluoro-4-methylbenzyl 3-[(1Z)-2-chloro-3,3,3-trifluoroprop-1-en-1-yl]-2,2-dimethylcyclopropanecarboxylic acid) was purchased from Sigma Aldrich. Tefluthrin stock solutions were prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM ADVASEP-7 (Sigma) was added to this washing solution in an effort to reduce background staining (Kay et al. ...
-
bioRxiv - Microbiology 2020Quote: ... For this, NHS-CF555 (5 µl, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNP (500 µl) ...
-
bioRxiv - Neuroscience 2023Quote: All candidate ASMs were dissolved in 100% DMSO (Dimethyl sulfoxide, Sigma Aldrich, CAS: 67-68-5) to a final stock concentration of 100 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... stored for 30 min at 4°C and fixed with 4% paraformaldehyde (Sigma Aldrich) for 10 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were fixed with 4% paraformaldehyde (PFA, Electron Microscopy Services) containing 4% sucrose (Sigma) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... organoids were treated with 0.5 μM 4-hydroxy-tamoxifen (4-OHT; Sigma Aldrich, H7904) for up to 120 h ...
-
bioRxiv - Neuroscience 2022Quote: 4-aminopyridine (4-AP, fampridine; Cat# 275775; ≥ 99% purity; Sigma-Aldrich, St. Louis, MO) was dissolved in sterile saline (0.9% sodium chloride ...
-
bioRxiv - Neuroscience 2022Quote: 4-hydroxy-tamoxifen stock solutions were made by dissolving 4-hydroxy- tamoxifen (Sigma, H7904) into pure ethanol at 10 mg/ml ...
-
bioRxiv - Bioengineering 2022Quote: 4-Nitrophenyl β-D-glucuronide (4-NPG, CAS no. 10344-94-2) (Sigma-aldrich) was prepared in 50 mM sodium phosphate buffer (Na-PB ...
-
bioRxiv - Neuroscience 2020Quote: ICA-121431 (ICA cmpd) and 4-aminopyridine (4-AP) was obtained from Sigma Aldrich Co ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tamoxifen as (Z)-4-Hydroxytamoxifen (4-OHT; 1uM and 5uM, Sigma-Aldrich; Cat# H7904), Recombinant GDNF (10ng/ml ...