Labshake search
Citations for Millipore Sigma :
3151 - 3200 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1× SATO [100 µg/ml human apo-transferrin (Sigma), 100 µg/ml BSA ...
-
bioRxiv - Immunology 2022Quote: ... and anti-human CD28 antibody (5μg/ml) (#MABF408, Millipore). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.25 mg/ml human plasma fibronectin (Sigma-Aldrich, 341635), 0.25 mg/ml unlabelled vitronectin (PeproTech ...
-
bioRxiv - Immunology 2023Quote: ... depleted human serum lacking IgA/IgG/IgM (Sigma-Aldrich) was used as a negative control.
-
bioRxiv - Genetics 2022Quote: ... and 10% v/v human AB serum (Sigma-Aldrich). Recombinant human macrophage colony-stimulating factor (CSF1 ...
-
bioRxiv - Microbiology 2023Quote: ... Human embryonic kidney 293T cells (Cat. N° 12022001, Sigma) were cultured in DMEM-10% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... or 2.5 µg of human plasma fibronectin (Sigma-Aldrich), or 1.5 µg of human complement C3b (Complement Technology ...
-
bioRxiv - Bioengineering 2023Quote: ... with 10 µg ml-1 human transferrin (Sigma-Aldrich). Primary human gingival epithelial cells were cultured in keratinocyte serum-free medium (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... The Anti-human IGFBP2 ELISA kit (Sigma, #RAB0233-1KT) was used to quantify IGFBP2 protein in the supernatants according to the manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2023Quote: ... were coated with anti-human polyvalent immunoglobulins (Sigma, I1761) in a 1:1000 dilution and stored at 4 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific Nestin (hNestin, Sigma, Abd69, 1:1000), anti-Sox2 (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: FDT standards were prepared in human plasma (Sigma Aldrich), whereby 20 μL plasma samples were spiked with various known concentrations of [19F]FDT i.e ...
-
bioRxiv - Immunology 2023Quote: ... were coated with goat anti-human IgG (Sigma #I2136) antibody at a concentration of 4 µg/ ml diluted in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Human A2780 cells (catalog #: 93112519) were purchased from Sigma. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg/ml human insulin (Sigma-Aldrich, I9278). At day 4 of differentiation ...
-
bioRxiv - Molecular Biology 2023Quote: ... of Human chorionic gonadotropin (hCG) (Millipore Sigma, CG5-1VL). At 16 h post hCG injection ...
-
bioRxiv - Immunology 2023Quote: ... Human 80 Plex kits were purchased from EMD Millipore Corporation ...
-
bioRxiv - Microbiology 2023Quote: ... and 200 μL human serum (Sigma, St. Louis, MO). One 10 mL tube of whole blood yielded 1 mL of neutrophil-only solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 µg/ml human insulin (Sigma-Aldrich, cat.no. I9278), 0.5 µg/ml hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse monoclonal anti-human NEFH (Sigma [ab142]; 1:400), rabbit antihuman SST (ImmunoStar 20067 ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 1% human serum (Sigma Aldrich Cat #H6914), 1% P/S ...
-
bioRxiv - Neuroscience 2023Quote: ... Free CysC (human urine CysC; Millipore Sigma #240896-50UG) was dissolved in 100mM sodium acetate buffer pH = 4.5 and added at a concentration of 0.15µM into the maintenance medium after OGD exposure ...
-
bioRxiv - Microbiology 2023Quote: - lactoferrin (Lactoferrin human, Sigma-Aldrich, USA, cat. no. L4040) 2 mg/mL solution in Dulbecco’s Phosphate Buffered Saline (Sigma-Aldrich ...
-
bioRxiv - Genetics 2024Quote: The AC16 human cardiomyocyte cell line (Millipore Sigma SCC109) was cultured in Dulbecco’s Modified Eagle’s Medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10% heat inactivated Human AB serum (HS, Sigma-Aldrich), 6000 IU/ml recombinant human IL2 (Peprotech) ...
-
bioRxiv - Pathology 2024Quote: To prepare the COLIV (derived from human placenta-Sigma) stock solution ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:4000 human insulin (9.5-11.5 mg/mL; Sigma). The next day ...
-
bioRxiv - Cancer Biology 2024Quote: ... and mouse anti-human anti-Vimentin (Sigma-Aldrich, CBL202) in 0.5% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... or mouse anti-human BCL-XL (EMD Millipore MAB3121) antibodies were added to lysate aliquots and incubated at 4°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Ovulation was induced with human chorionic gonadotropin (Sigma CG10), and embryos were collected and manipulated according to standard procedure58 ...
-
bioRxiv - Immunology 2024Quote: ... human myeloma IgE (0.3 µg/mL, Sigma-Aldrich, #401152) was used for sensitizing the cells in the presence of recombinant human IL-4 (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... human leukemia inhibitory factor (hLIF, 10 ng/ml, Millipore), SB431542 (2 µM) ...
-
bioRxiv - Immunology 2024Quote: ... with 5% v/v heat-inactivated human serum (Sigma), 1% v/v Glutamax (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5% human AB serum (Millipore Sigma, H4522), 2 mM L-glutamine (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... and murine interleukin 3 (IL3)-producing WEHI-3 cells were cultured in Dulbecco’s modified Eagle medium (DMEM, Sigma-Aldrich) supplemented with 10% FBS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2-Methoxy-3-methyl-1,4-BQ was synthesized as follows: 2 mmol 2-Methoxy-3-methyl-1,4-hydroquinone (Sigma Aldrich) and 2 mmol NaIO4 were mixed in a 50 ml round-bottom flask and 10 ml CH2Cl2 and 5 ml of water were then added ...
-
bioRxiv - Bioengineering 2022Quote: ... and then crosslinked with carbodiimide chemistry in PBS solution:1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Sigma-Aldrich) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Plant Biology 2019Quote: ... Labeled standards for indole-3-acetic acid and N-(3-indolylacetyl)-DL-aspartic acid were obtained from Sigma-Aldrich. Calibration curves were linear (r values = >0.99 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were further washed with TBS and treated with DAB solution for 20 minutes (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 2.5% Nickel Sulphate Hexahydrate ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mmI.D. x 150 mmL, 3 μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biophysics 2022Quote: 1,2-dioleoyl-sn-glycero-3-phosphocoline (DOPC) (TebuBio) and 1,2-dioleoyl-sn-glycero-3-phospho(1’-rac-glycerol) (sodium salt) (DOPG) (Sigma) were dissolved in chloroform ...
-
bioRxiv - Cell Biology 2022Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Immunology 2020Quote: The following reagents were used in this study: 3-methyladenine (3-MA; M9281; Sigma-Aldrich, St. Louis, MO, USA), dimethylsulfoxide (D2650 ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... paws were incubated twice for 5min with methanol 50% BABB (1/3 benzylalcohol and 2/3 benzylbenzoate, from Sigma), and then three times in pure BABB for 5min each (or until the sample is cleared) ...