Labshake search
Citations for Millipore Sigma :
2851 - 2900 of 10000+ citations for QuantiChrom β N Acetylglucosaminidase Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... membranes were blocked as described above and β-actin was detected using mouse β-acting specific monoclonal antibody (Sigma, 1:10,000 dilution) and peroxidase-conjugated goat anti-mouse IgG (Jackson Immunolabs ...
-
bioRxiv - Biochemistry 2022Quote: PARP10-CD protein was auto-MARylated through incubation for 20 minutes at 37°C with 1 mM final concentration of β-Nicotinamide Adenine Dinucleotide (β NAD+) (Millipore-Sigma) in a reaction buffer (50 mM HEPES ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The ratio of protein level or phosphorylation levele against control β-actin protein level (detected with a mouse monoclonal Anti-β-Actin-Peroxidase antibody (A3854 Sigma)) was normalized to untreated wt sample mean.
-
bioRxiv - Microbiology 2019Quote: ... Relative TLR3 protein expression levels between WT and CRISPR modified cells were obtained by measuring TLR3’s expression against the intracellular β-Actin control protein bound to an anti-β-Actin monoclonal antibody (1:300; Sigma). Protein detection in WES was accomplished according to the manufacturer’s protocol using streptavidin-HRP based methodology (ProteinSimple) ...
-
bioRxiv - Microbiology 2024Quote: ... a 10 μM solution of purified PAPR10-CD protein was incubated for 20 minutes at 37°C with 1 mM final concentration of β-Nicotinamide Adenine Dinucleotide (β NAD+) (Millipore-Sigma) in a reaction buffer (50 mM HEPES ...
-
bioRxiv - Cell Biology 2023Quote: ... western blot normalization against total β-actin in full was performed (anti-β-actin mouse monoclonal, A5441, Sigma, U.S., dilution: 1:40000). ECL chemiluminescence detection system (Cytiva ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... N-acetyl-DL-leucine was obtained from Molekula (#73891210) and N-acetyl-L-leucine was obtained from Sigma Aldrich (#441511).
-
bioRxiv - Biophysics 2020Quote: ... were added to 1 mL of 10 mg∙mL−1 of N-(3-dimethylaminopropyl)-N’-ethylcabodiimidie hydrochloride (EDC, Sigma-Aldrich) dissolved in 100 mM sodium phosphate ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... SAG1.3 (3-Chloro-N-[trans-4-(methylamino)cyclohexyl]-N-[[3-(4-pyridinyl)phenyl]methyl]benzo[b]thiophene-2-carboxamide) was from Sigma. Cyclopamine-KAAD and SANT-1 ((4-Benzyl-piperazin-1-yl)-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-ylmethylene)-amine ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were dissolved in 50 μL of 20 mg/ml methoxyamine hydrochloride in pyridine for 1.5 h at 33°C followed by derivatization with N-Methyl-N-(trymethylsolyl)trifluoroacetamide (MSTFA, Sigma Aldrich) for 2 h at 35°C.
-
bioRxiv - Microbiology 2021Quote: ... 4 mg of Arixtra was added to 10 volumes (w/w) of N-Methy-N-(trimethylsilyl)-trifluoroacetamide (MTSTFA, Sigma, ≥98.5%) and 100 volumes (v/w ...
-
Interactions with stromal cells promote a more oxidized cancer cell redox state in pancreatic tumorsbioRxiv - Cancer Biology 2020Quote: ... and incubated at 37° C for 90 minutes followed by addition of 20μL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert–Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated at 37°C for 90 minutes followed by addition of 20µL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert– Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Plant Biology 2020Quote: ... The combined organic phase was dried using CentriVap Cold Traps (Labconco) and derivatized using bis-(N,N,-trimethylsilyl)-tri-fluoroacetamide (BSTFA; Sigma) as described previously (Franke et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Terminal cellular differentiation was induced with 10 μM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT; Sigma-Aldrich) while mucus-secretion was enhanced with 10 nM phorbol 12-myristate 13-acetate (PMA ...
-
bioRxiv - Cell Biology 2021Quote: SK-N-SH-N cells were plated onto 6-well tissue culture plates coated with poly-L-lysine (Sigma-Aldrich). Cells were plated at 3×105 cells/ml in MEMα medium containing a very low-serum level (2% FBS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 1h at 37°C and then with 20μL 1% tert-butyldimethylchlorosilane in N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma Aldrich) for 3h at 60°C ...
-
bioRxiv - Cell Biology 2022Quote: ... in pyridine at 70°C for 15 min followed by addition of N-tert-Butyldimethylsiyl-N-methyltrifluoroacetamide (MTBSTFA, Sigma-Aldrich) for 1 hour ...
-
bioRxiv - Plant Biology 2021Quote: ... The sample was then derivatized by adding 60 μL N-methyl-N-(trimethylsilyl)trifluoro acetamide (MSTFA) (Cat# 69479; Sigma-Aldrich) and incubating for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The gelatin was subsequently cross-linked using N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC hydrochloride) (Sigma Aldrich Catalog No-03450) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Molecular Biology 2019Quote: ... Small RNAs were crosslinked to the membrane by chemical crosslink using N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC, Sigma-Aldrich). Membrane was pre-hybridized for 20 min with PerfectHyb(tm ...
-
bioRxiv - Genomics 2021Quote: ... 2X reverse crosslinking buffer (2% SDS, 0.2mg/mL proteinase K, and 100mM N,N-Dimethylethylenediamine, pH 6.5 [Sigma Aldrich D158003]) was added at equal volume to transposed cells and reversal of crosslinks was performed at 37 degrees overnight with 600 rpm shaking ...
-
bioRxiv - Biophysics 2019Quote: ... 2 M NaCl, 8.625% [w/w, Sigma] sodium acrylate, 2.5% [w/w, Sigma] acrylamide, 0.15% [w/w, Sigma] N,N′-methylenebisacrylamide) was mixed and cooled to 4 °C before use ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were treated for 16 hours with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-phenylglycin T-butyl ester (DAPT) (Sigma Aldrich), an inhibitor of γ-secretase ...
-
bioRxiv - Neuroscience 2021Quote: ... received bilateral infusions of either vehicle (aCSF; pH 7.4; males n = 5; females n = 4) or the GABAA receptor agonist muscimol (Sigma Aldrich, M1523 ...
-
bioRxiv - Immunology 2022Quote: ... 2X reverse crosslinking buffer (2% SDS, 0.2mg/mL proteinase K, and 100mM N,N-Dimethylethylenediamine, pH 6.5 [Sigma Aldrich D158003]) was added at equal volume to transposed cells and reversal of crosslinks was performed at 37°C overnight with 600 rpm shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with the noradrenergic neuron specific neurotoxin N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP4; Sigma, C8417) once at a dose of 50 mg/kg (i.p.) ...
-
bioRxiv - Genetics 2023Quote: ... Pregnant female mice were given one intraperitoneal (i.p.) injection of 30 mg/kg body weight of the carcinogen N-ethyl-N-nitrosourea (ENU, Sigma N3385) dissolved in phosphate-buffered citric acid (pH 5.8 ...
-
bioRxiv - Microbiology 2022Quote: ... The dried remainder of eluate 2 was dissolved in 50 µl dry acetonitrile and 50 µl N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide containing 1% tert-butyldimethylsilyl chloride (Sigma) and kept at 70°C for 30 min ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... To the bead suspension was added 0.5 mL of 750 mM of N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC) in water (Sigma-Aldrich) and the mixture was incubated for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... animals were injected with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (Sigma, Cat no. D5942) (10 mg/kg/day ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The ML321 was dissolved in a small amount of N,N-dimethylacetamide (DMA) with previously heated Tween-80 (Sigma-Aldrich) and vortexed until the solution was solubilized ...
-
bioRxiv - Developmental Biology 2023Quote: ... we prepared NGM dishes as above and added paraquat (N,N’-dimethyl-4,4’-bipyridium dichloride, 36541, Sigma-Aldrich, Burlington MA) to the molten agar to a final concentration of 40 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were then further incubated with 20 µL of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide with 1% tert-Butyldimethylchlorosilane (TBDMS) (Sigma) at 60 °C for 60 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult female SNSiDTR (n=6) and TrkBiDTR (n=19) mice were injected i.p with 40 μg/kg DTX (Sigma, D0564) with a second dose after 72 h ...
-
bioRxiv - Immunology 2023Quote: ... were added followed by dropwise addition of 500 µl 2X BES (50 mM N,N-bis(2hydroxyethyl)-2-aminoethanesulfonic acid (Sigma) + 280 mM NaCl (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dried samples were first resuspended in a 1:1 v/v mixture of a 1% solution of N,N-diisopropylethylamine (Sigma) and a 1% solution of pentaflurobenzylbromine (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: Pharmacological experiments were carried out on PCs during simultaneous somatic and dendritic recordings after 10 minutes of control recording using ACSF with the following drugs: 20 µM 4- (N-ethyl-N-phenylamino)-1,2 dimethyl-6-(methylamino)pyrimidinium chloride (ZD7288) (Sigma-Aldrich), or 1 µM TTX ...
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated for 3 hours in serum-free MEM containing 150 µg/mL N-ethyl-N-nitrosourea (ENU) (Sigma). Cells were then maintained in ENU-free medium for 9 days to allow mutations to establish and existing HPRT to degrade ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Cell Biology 2024Quote: ... worms were incubated for 4 hours at 22 °C in 0.5 mM N-nitroso-N-ethylurea (ENU, Sigma Aldrich N3385), washed thoroughly in M9 buffer (22 mM KH2HPO4 ...
-
bioRxiv - Immunology 2024Quote: ... 50 mM of iodoacetamide (BioUltra, Millipore Sigma #I1149) (1 M stock in anhydrous N, N-Dimethylformamide (DMF (Millipore Sigma #227056)) ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 µM β-estradiol (Sigma-Aldrich, Steinheim, Germany). Cells were split every 2 days.
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-β-actin (#A2228, 1:10,000, Sigma-Aldrich). Appropriate secondary antibodies (IgG-Fc Specific-Peroxidase ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1μM L-asparagine and 50μM β-mercaptoethanol (Sigma Aldrich). These cell suspensions were then frozen in 90% FBS/10% DMSO for long- term storage and transplantation.
-
bioRxiv - Cell Biology 2020Quote: ... and anti-β-actin mouse (Sigma, #A5441; 1:1,000), horseradish peroxidase-conjugated anti-mouse (Dako ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-β-tubulin dilution 1:5000 (Sigma-Aldrich) and 1 hour at room temperature with HRP-conjugated secondary antibodies (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... or methyl-β-cyclodextrin (9.5 µM, Sigma-Aldrich C4555) were added to growth media at normal growth conditions for one hour prior to unroofing and fixation.
-
bioRxiv - Cell Biology 2020Quote: ... 7.5% FBS and 10−4 M β-mercaptoethanol (Sigma) plus 50 ng/mL ...