Labshake search
Citations for Millipore Sigma :
2651 - 2700 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The human ORF sequence encoding for GSDMD was obtained from the Viral Vector Facility (LUMC) human ORF (cDNA) library from Sigma-Aldrich. The gene ORF was obtained in pDONR223 entry vectors and amplified by PCR with overhang primers to introduce partial sequences of an N-terminal FLAG-tag and C-terminal Myc-tag ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein endothelial cells (HUVECs) were isolated from human umbilical cords using collagenase type I (Sigma-Aldrich, 400 U/mL) to separate the cell layer surrounding the vein lumen ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM of 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl (EDC, 22980-Sigma-Aldrich, St. Louis, MO, USA) and 5 mM of N-hydroxysulfosuccinimide sodium salt (NHS ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Diflufenican (N-(2,4-difluorophenyl)-2-[3-(trifluoromethyl)phenoxy]-3-pyridinecarbox-amide) was purchased from Sigma-Aldrich (Taufkirchen, Germany). Diflufenican metabolites AE B107137 (2-[3-(Trifluoromethyl)phenoxy]nicotinic acid ...
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μg/ml prolactin (mouse recombinant for qPCR, western blot, immunohistochemistry and contraction control; Sigma or Peprotech) or sheep pituitary prolactin for time-lapse and confocal imaging ...
-
bioRxiv - Immunology 2019Quote: ... A subset of mice was treated with IP with recombinant DNase I (20 mg/kg, Sigma-Aldrich) 2 hours after LPS injection24 ...
-
bioRxiv - Microbiology 2021Quote: ... enzymatic activity of recombinant CynD was measured at pH 8.0 using the Ammonia Assay Kit (Sigma-Aldrich). A concentration of 500 nM of CynD was used in all reactions with the following cyanide concentrations ...
-
bioRxiv - Microbiology 2021Quote: ... Digestion of extended E34TSP was done according to the recombinant Enterokinase user protocol TB150 Rev.C 0107(Novagen). The extent of proteolytic activity on our TSP was calibrated via SDS PAGE analysis.
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant MejAgo protein expression and Ni-affinity chromatography purification procedures were performed according to user manual(Novagen). In perticular ...
-
bioRxiv - Microbiology 2022Quote: ... and the recombinant protein expression was induced with 0.5 mM isopropyl-D-1-thiogalactopyranoside (IPTG; Sigma-Aldrich). The bacteria were incubated at 18°C for additional 18 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Viral titers were calculated from a standard curve generated using recombinant reverse transcriptase (Millipore catalog no. 382129).
-
bioRxiv - Immunology 2021Quote: ... recombinant SARS-COV-2 Spike protein was desalted and concentrated with C4 ZipTips (Merck Millipore, Darmstadt, Germany) and spotted on a ground steel target using 2’,5’-Dihydroxyacetophenone ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant Py-S2 proteins fused to hexa-histidine tag were expressed in Rossetta2 (DE3) (EMD Millipore/Novagen) and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant Py-S2 proteins fused to hexa-histidine tag were expressed in Rossetta2 (DE3) (EMD Millipore/Novagen) and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech) ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant Py-S2 proteins fused to hexa-histidine tag were expressed in Rossetta2 (DE3) (EMD Millipore/Novagen) and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech) ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant Py-S2 proteins fused to hexa-histidine tag were expressed in Rossetta2 (DE3) (EMD Millipore/Novagen) and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Sf9 cells were transfected with recombinant bacmid DNA using Escort™ IV Transfection Reagent (Sigma, Cat # L3287) in 6 well plates ...
-
bioRxiv - Plant Biology 2021Quote: GST and Recombinant Virp1-GST proteins were expressed in Escherichia coli Rosetta strain (EMD Millipore, Burlington, MA). Cells were grown overnight at 37°C in LB media supplied with ampicillin (0.1 mg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted recombinant proteins were concentrated in Amicon Ultra-4 centrifugal filter units with 30-kDa cutoff (Millipore), concentrations were determined using the DC BCA protein assay (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant protein was then eluted in lysis buffer containing 500 μg/mL 3x-FLAG peptide (Sigma-Aldrich) for 1 hr with rotation at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression of the recombinant proteins was checked by Western blotting with monoclonal anti-HA antibodies (Sigma).
-
bioRxiv - Biophysics 2021Quote: ... and (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, A3648) in a v:v:v ratio of 100:5:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cultured on 3% polyHEMA (Sigma, P3932) coated 96 well plate for 48 h in a 37 °C humidified incubator with 5% carbon dioxide.
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... sodium-3-methyl-2-oxobutyrate (ketovaline, Sigma), 3-methyl-2-oxovaleric acid sodium salt (ketoisoleucine ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 μM Indole-3-acetic acid (Sigma) was added 8 h after released ...
-
bioRxiv - Cell Biology 2020Quote: ... 1i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat.no ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Sigma), 50mM EDTA ...
-
bioRxiv - Cell Biology 2020Quote: ... – 50 μM in DMSO (3) Tunicamycin (Sigma) – 5 μg/ml in DMSO for 6hr (4 ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Genetics 2021Quote: ... Ni-NTA resin (EMD Millipore, 70691-3) was used to remove unreacted His-tagged nanobodies and His-tagged Sortase 5M enzyme ...
-
bioRxiv - Biochemistry 2020Quote: ... or 3) Lipopolysaccharide (LPS) (Sigma-Aldrich L3024) + interferon-γ (IFNγ ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 mM deferoxamine from Sigma (# BP987). Next ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-Indoleacetic acid (Auxin, Sigma-Aldrich, I2886) was dissolved in 100% ethanol and diluted 400 times in the culture medium obtaining concentrations as indicated ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3% Bovine Serum Albumin (BSA; Sigma, A2153), 0.5% Triton™X-100 (Sigma ...