Labshake search
Citations for Millipore Sigma :
2401 - 2450 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant HNRNPH1 was analyzed using an anti-FLAG antibody (F1804, Sigma-Aldrich, St. Louis, MO) and an anti-mouse HRP secondary antibody (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant proteins to be labeled with fluorophores were concentrated using Amicon Ultra Centrifugal Filter units (Millipore) to ∼100 μM ...
-
bioRxiv - Pathology 2023Quote: ... 10 µL of recombinant Tat-Cre at 8.8 µg/µL supplemented with Fast Green FCF (Sigma) to facilitate visualization of TAT-Cre delivery were intravaginally injected to each uterine horn using a micropipette tip (Figure 4A) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were cultured with recombinant retroviruses or lentiviruses and 10 μg/mL polybrene (H9268; Sigma-Aldrich), and they were selected in growth medium with puromycin (14861-71 ...
-
bioRxiv - Cell Biology 2024Quote: ... Fractions containing recombinant protein were pooled and concentrated on a 30K Amicon Ultra Centrifugal filter (Millipore). Glycerol at 10% final was added to the sample and protein concentration was estimated using Bradford detergent compatible assay (Pierce) ...
-
bioRxiv - Immunology 2024Quote: ... 20 ng/mL recombinant mouse GM-CSF (Miltenyi-Biotec) and 0.5 μM ß-estradiol (Sigma-Aldrich) and transduced with ER-HoxB8 retrovirus using Lentiblast Premium (OZ Biosciences).71 After two weeks ...
-
bioRxiv - Systems Biology 2021Quote: ... purified LC and naïve CD4+ T cells or TRMs were co-cultured in human serum supplemented media (RPMI, Gibco, UK, 10% human serum, Sigma, UK ...
-
bioRxiv - Cancer Biology 2020Quote: Human neutrophils were obtained from fresh human peripheral blood from healthy volunteers and were isolated using a Percoll (Sigma-Aldrich) gradient.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were probed with polyclonal goat anti-human ACE2 (1:500, AF933, R&D Biosystems) or rabbit anti-human beat-Actin (1:2500, 6L12, Sigma) followed by donkey anti-goat IRdye 680CW or goat anti-rabbit IRdye 800CW (Abcam) ...
-
bioRxiv - Physiology 2020Quote: ... For insulin clearance during an insulin challenge, mice were given human insulin (1 U/kg, NovoRapid) or human C-peptide (50 µg/kg, Sigma) by intraperitoneal injection and blood samples were collected by tail vein sampling at 0 ...
-
bioRxiv - Microbiology 2020Quote: ... membranes were probed with 1 in 10,000 dilution of human anti-SIC followed by 1 in 50,000 dilution of HRP-conjugated goat anti-human IgG (Sigma-Aldrich). To directly compare detection of SIC fragments by purified human and rabbit anti-SIC antibodies ...
-
bioRxiv - Cell Biology 2022Quote: The human alveolar carcinoma epithelial cell line A549 (ATCC, CCL-185) and human colorectal adenocarcinoma cell line HT29 (Sigma Aldrich) were utilized for toxicological evaluation ...
-
bioRxiv - Microbiology 2020Quote: ... 15 µl of secondary antibody (anti human Fab-HRP: Jackson ImmunoResearch, cat# 109-035-097; anti human IgG-HRP: Sigma, cat# A6029-1ML ...
-
bioRxiv - Immunology 2022Quote: ... alpha enolase (in-house expressed human) and collagen II (bovine purified, chondrex) and at 0.5 μg/ml hIgG1 to citrullinated fibrinogen (human purifed, Sigma Aldrich).
-
bioRxiv - Microbiology 2023Quote: Primary human macrophages (MΦs) were cultured in macrophage medium (RPMI-1640 GlutaMAX™ (Thermo) supplemented with 4% human AB serum (Sigma), 100 μg/ml penicillin-streptomycin (Sigma) ...
-
bioRxiv - Systems Biology 2024Quote: ... The cells were then incubated with 1ug/ul primary antibody (For TRUB1 staining, TRUB1 Rabbit anti-human polyclonal, 50-172-8037, Protein tech; for PUS7 staining, PUS7 Rabbit anti-human, HPA024116, Sigma) in 1% BSA/PBS-Triton (0.1% ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg of protein from each sample were incubated with 3 ug of HOXA9 (Millipore # 07-178) or Rabbit IgG Isotype control (Invitrogen # 02-6102 ...
-
bioRxiv - Biophysics 2021Quote: ... Plasminogen (human plasma purified protein, Sigma-Aldrich, Germany) and Fibrinogen (human plasma purified protein ...
-
bioRxiv - Biophysics 2021Quote: ... and Fibrinogen (human plasma purified protein, Sigma-Aldrich). Experimental conditions are presented in the table I.
-
bioRxiv - Biophysics 2021Quote: Plasminohen (human plasma purified protein, Sigma-Aldric, Germany)
-
bioRxiv - Cancer Biology 2021Quote: ... and Human specific Ki67 (MAB4383, 1:500, Millipore), followed by secondary antibody Envision+ anti-mouse labeled-polymer (Dako/Agilent) ...
-
bioRxiv - Biochemistry 2020Quote: LX-2 human hepatic stellate cells [47] (Millipore) were cultured in DMEM supplemented with 10% fetal bovine serum at 37°C under 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... human plasma-derived (Sigma, Cat. No #: F4883-500MG) were purchased from Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... human plasma-derived (Sigma, Cat. No #: T6884-100UN) and Fibronogen ...
-
bioRxiv - Cell Biology 2022Quote: ... Human cells were pretreated with glycine (Millipore, 104201) at a concentration of 50 mM for at least 10 minutes before stimuli was added.
-
bioRxiv - Bioengineering 2022Quote: ... human [Leu15]-gastrin I (10 nM; Millipore Sigma), N-acetyl cysteine (500 μM ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Thrombin from human plasma was obtained from Millipore-Sigma (Cat ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with 20% Human serum (Sigma-Aldrich, UK), and used up to passage 4.
-
bioRxiv - Bioengineering 2019Quote: ... and human plasma fibronectin (Millipore Sigma, Catalog #FC010) were conjugated to fluorophores using the DyLight™ 488 Microscale Labeling Kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 IU of human chorionic gonadotropin (Sigma) were injected into 3 week old B6C3F1/J female mice by intraperitoneal injection to stimulate superovulation ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human α-thrombin (20 nM, T6884, Sigma, USA) and human α-FXIIa (20 nM ...