Labshake search
Citations for Millipore Sigma :
2101 - 2150 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated at 37°C for 90 minutes followed by addition of 20µL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert– Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Plant Biology 2020Quote: ... The combined organic phase was dried using CentriVap Cold Traps (Labconco) and derivatized using bis-(N,N,-trimethylsilyl)-tri-fluoroacetamide (BSTFA; Sigma) as described previously (Franke et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 1h at 37°C and then with 20μL 1% tert-butyldimethylchlorosilane in N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma Aldrich) for 3h at 60°C ...
-
bioRxiv - Cell Biology 2022Quote: ... in pyridine at 70°C for 15 min followed by addition of N-tert-Butyldimethylsiyl-N-methyltrifluoroacetamide (MTBSTFA, Sigma-Aldrich) for 1 hour ...
-
bioRxiv - Plant Biology 2021Quote: ... The sample was then derivatized by adding 60 μL N-methyl-N-(trimethylsilyl)trifluoro acetamide (MSTFA) (Cat# 69479; Sigma-Aldrich) and incubating for 30 min at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... 2X reverse crosslinking buffer (2% SDS, 0.2mg/mL proteinase K, and 100mM N,N-Dimethylethylenediamine, pH 6.5 [Sigma Aldrich D158003]) was added at equal volume to transposed cells and reversal of crosslinks was performed at 37 degrees overnight with 600 rpm shaking ...
-
bioRxiv - Biophysics 2019Quote: ... 2 M NaCl, 8.625% [w/w, Sigma] sodium acrylate, 2.5% [w/w, Sigma] acrylamide, 0.15% [w/w, Sigma] N,N′-methylenebisacrylamide) was mixed and cooled to 4 °C before use ...
-
bioRxiv - Neuroscience 2021Quote: ... received bilateral infusions of either vehicle (aCSF; pH 7.4; males n = 5; females n = 4) or the GABAA receptor agonist muscimol (Sigma Aldrich, M1523 ...
-
bioRxiv - Immunology 2022Quote: ... 2X reverse crosslinking buffer (2% SDS, 0.2mg/mL proteinase K, and 100mM N,N-Dimethylethylenediamine, pH 6.5 [Sigma Aldrich D158003]) was added at equal volume to transposed cells and reversal of crosslinks was performed at 37°C overnight with 600 rpm shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with the noradrenergic neuron specific neurotoxin N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP4; Sigma, C8417) once at a dose of 50 mg/kg (i.p.) ...
-
bioRxiv - Neuroscience 2024Quote: Pharmacological experiments were carried out on PCs during simultaneous somatic and dendritic recordings after 10 minutes of control recording using ACSF with the following drugs: 20 µM 4- (N-ethyl-N-phenylamino)-1,2 dimethyl-6-(methylamino)pyrimidinium chloride (ZD7288) (Sigma-Aldrich), or 1 µM TTX ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The ML321 was dissolved in a small amount of N,N-dimethylacetamide (DMA) with previously heated Tween-80 (Sigma-Aldrich) and vortexed until the solution was solubilized ...
-
bioRxiv - Microbiology 2022Quote: ... The dried remainder of eluate 2 was dissolved in 50 µl dry acetonitrile and 50 µl N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide containing 1% tert-butyldimethylsilyl chloride (Sigma) and kept at 70°C for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult female SNSiDTR (n=6) and TrkBiDTR (n=19) mice were injected i.p with 40 μg/kg DTX (Sigma, D0564) with a second dose after 72 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were then further incubated with 20 µL of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide with 1% tert-Butyldimethylchlorosilane (TBDMS) (Sigma) at 60 °C for 60 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dried samples were first resuspended in a 1:1 v/v mixture of a 1% solution of N,N-diisopropylethylamine (Sigma) and a 1% solution of pentaflurobenzylbromine (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... were added followed by dropwise addition of 500 µl 2X BES (50 mM N,N-bis(2hydroxyethyl)-2-aminoethanesulfonic acid (Sigma) + 280 mM NaCl (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... we prepared NGM dishes as above and added paraquat (N,N’-dimethyl-4,4’-bipyridium dichloride, 36541, Sigma-Aldrich, Burlington MA) to the molten agar to a final concentration of 40 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Genetics 2023Quote: ... Pregnant female mice were given one intraperitoneal (i.p.) injection of 30 mg/kg body weight of the carcinogen N-ethyl-N-nitrosourea (ENU, Sigma N3385) dissolved in phosphate-buffered citric acid (pH 5.8 ...
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Immunology 2024Quote: ... 50 mM of iodoacetamide (BioUltra, Millipore Sigma #I1149) (1 M stock in anhydrous N, N-Dimethylformamide (DMF (Millipore Sigma #227056)) ...
-
bioRxiv - Cell Biology 2024Quote: ... worms were incubated for 4 hours at 22 °C in 0.5 mM N-nitroso-N-ethylurea (ENU, Sigma Aldrich N3385), washed thoroughly in M9 buffer (22 mM KH2HPO4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-methylamine (3-MA) and bafilomycin (Sigma Aldrich) were used ...
-
bioRxiv - Cell Biology 2019Quote: The 3-Bromopyruvatic Acid (3-BrPA) powder (Sigma) was dissolved in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... and GIGYF2 shRNA#3 (shGIGYF2#3) (Sigma, TRCN0000135088).
-
bioRxiv - Neuroscience 2020Quote: ... 3’-cyclic nucleotide 3’- phosphodiesterase (CNP, Millipore MAB326) and proteolipid protein (PLP ...
-
bioRxiv - Cell Biology 2022Quote: ... 14-3-3 (Millipore AB9748-I, 1:2000); TOPO II (Abcam 109524 ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2020Quote: ... a 3-30% or 3-15.5% OptiPrepTM (Sigma) continuous gradient was prepared in a buffer containing 78 mM KCl ...
-
bioRxiv - Neuroscience 2021Quote: ... DAB (3-3’-diaminobenzidine, Sigma-Aldrich, D8001-10G) was dissolved in 0.1 N HCl at a concentration of 5.4 mg/ml and subsequently diluted ten fold into blocking solution ...
-
bioRxiv - Immunology 2020Quote: ... 3-NP (3-Nitropropionic acid, 62.5 μM; Sigma) and water-soluble cholesterol (50 mM ...
-
Community-based Reconstruction and Simulation of a Full-scale Model of Region CA1 of Rat HippocampusbioRxiv - Neuroscience 2024Quote: ... and then in DAB (3, 3’ diaminobenzidine, Sigma) to reveal the morphology of the recorded neurons ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 mM 3-methyl adenine (3-MA, Sigma), 5 µM neutral sphingomyelinase inhibitor GW4869 (SelleckChem) ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and N-hydroxysulfosuccinimide (Sulfo-NHS ...
-
bioRxiv - Biophysics 2021Quote: ... n-octylglucoside (OG, Sigma-Aldrich, St. Louis, MO), 3-((3-cholamidopropyl ...
-
bioRxiv - Immunology 2021Quote: ... 0.5% n-Octyl-β-D-glucopyranoside (Merck Millipore). Finally lysates were subjected to chromatin shearing with Qsonica Sonicator Q700 (Thermoscientific ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.65 g N-hydroxysulfosuccinimide (NHS, Sigma-Aldrich), which was then mixed with another 200 mL ethanol (80% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4 mM N-ethylmaleimide (Sigma Cat. E3876) and 4 mM 1,10-phenanthroline (Sigma Cat ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... supplemented with N-ethylmaleimide (Sigma-Aldrich Merck, USA) and 1% cOmplete protease inhibitor (Roche ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2.5 mM DSG (Di(N-succinimidyl) glutarate) (Sigma) was added to the fixation buffer containing 1.8% of formaldehyde ...
-
bioRxiv - Biochemistry 2019Quote: ... Samples were treated with N-ethylmaleimide (NEM) (Sigma) at a concentration of 20 mM before further processing ...
-
bioRxiv - Cell Biology 2019Quote: ... N-acetylcysteine (NAC) were obtained from Sigma-Aldrich Chemical Co ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and N-Hydroxysuccinimide (NHS) were procured from Sigma–Aldrich Company (Darmstadt ...
-
bioRxiv - Immunology 2019Quote: ... or 20 μM nigericin (N-7143, Sigma-Aldrich) for 45 min ...
-
bioRxiv - Neuroscience 2020Quote: Clozapine-N-oxide (CNO) (Sigma: C0832, Tocris: 4936) prepared in saline was intraperitoneally injected (12 μg/g body weight)64 ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM N-Acetylcystine (Sigma Aldrich A9165-5G), 100 μg/ml Primocin (Invivogen ant-pm-1) ...
-
bioRxiv - Bioengineering 2019Quote: ... 1.25 mM N-acetylcysteine (Sigma Aldrich A9165-SG) and B27 Supplement (Gibco)] ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5 μM ascorbic acid (Sigma, Cat N° A4403), and 0.1% β-mercaptoethanol (Cat N° 31350010) ...