Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 6152 citations for IL 8 CXCL8 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma). Further purification was performed by ion exchange chromatography (Source Q for WT and the S897E ...
-
bioRxiv - Microbiology 2020Quote: ... The proteins were detected using the primary antibody (Mouse α-His at 1:2500 dilution, Sigma Aldrich) followed by the HRP conjugated secondary antibody (Sheep α-Mouse at 1:7000 dilution ...
-
bioRxiv - Biophysics 2020Quote: ... and passed through pre-equilibrated HIS-Select Ni-nitrilotriacetic acid resin (Ni-NTA) (Sigma-Aldrich Co., USA) at 4 °C for binding of 6x-His tagged protein ...
-
bioRxiv - Cell Biology 2022Quote: ... The following primary antibodies were used: anti-His (1: 2000, Cat No: 70796-4, Novagen, Madison, WI); anti-DNALI1 (1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The His-tag was removed by cleavage with 16 U of thrombin (Ref 27-0846-01, Sigma) added directly onto the beads for 2h at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... pneumoniae LicB with an N-terminal 10×His affinity tag in a modified pET-19b vector (Novagen) was overexpressed in E ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... plasmid coding for 6x-His-Cas9 were transformed in Rosetta DE3 Novagen competent cells (Merck Millipore, USA). Protein production was induced using autoinduction medium (Formedium ...
-
bioRxiv - Cell Biology 2020Quote: ... in the presence or the absence of 10 μg N-terminal-His-tagged ubiquitin (Sigma-Aldrich, #U5507), and ≈ 2 μg of purified recombinant mouse GST-Trim39 (WT ...
-
bioRxiv - Biophysics 2021Quote: ... The His-eluent was concentrated using a 30 kDa cutoff Amicon Ultra-4 centrifugal filter (Millipore UFC803008), filtered using a 0.22 μm Millex-GP PES membrane (Millipore SLGP033RS) ...
-
bioRxiv - Immunology 2022Quote: ... the 6x HIS tag region of the recombinant protein was removed following the vector manufacturers specifications (Novagen). This recombinant SmCI-1 was used to generate a rabbit anti-Sm-CI-1 polyclonal antibody using the Custom pAb service offered by Genscript.
-
bioRxiv - Microbiology 2022Quote: ... with the following modifications: Mouse anti-GST tag or mouse anti-His tag 1:200× (Sigma-Aldrich) and HRP-conjugated goat anti-mouse IgG 1:2,000× (Seracare Life Sciences ...
-
bioRxiv - Genetics 2023Quote: ... imidazole was removed from the eluted His-SIRT5 using ultra-0.5 centrifugal filter units (UFC501096, Merck Millipore). 500 µl of the recombinant SIRT5 elution fractionation was added to the ultra-0.5 centrifugal filter units and centrifuged at 14,000 x g for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Cancer Biology 2023Quote: ... pTB146 His-SUMO-mSTING (residues 139-378) was expressed in Rosetta (DE3) pLysS competent cells (Sigma-Aldrich). Cells were grown in 2xYT medium with 100 μg/mL ampicillin until they reached an OD600 of 1 ...
-
bioRxiv - Biochemistry 2023Quote: ... After several rounds of washing with His-AC washing buffer (supplemented with 0.1% Tween-20 (Sigma Aldrich), 0.1% NP-40 (Thermo Fischer Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell pellets were resuspended in 2% HI-FBS PBS with 1 µg/mL DAPI (Sigma Aldrich, #D9542) to stain dead cells ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte- human fibrinogen mixture (Sigma-Aldrich). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte-human fibrinogen mixture (Sigma-Aldrich) and 2µL of the mixture is carefully pipetted into the microwell ...
-
bioRxiv - Immunology 2021Quote: ... the amplified IL-22 gene was cloned into a pET32a (+) vector (Novagen, USA) using two restriction sites as shown in Figure 1b ...
-
bioRxiv - Neuroscience 2019Quote: ... interleukin alpha (IL-1a) (3 ng/ml; Sigma-Aldrich; Cat. No. I3901-5UG) and complement component 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-acetylated α-tubulin (clone 6-11B-1, Sigma-Aldrich, St. Louis, IL), anti-β-tubulin (E7 ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... Stimulated cells were treated with 68.7 ng/mL (8000IU) IL-4 (Sigma-Aldrich) and 5 μg/mL anti-CD40 (BioXCell ...
-
bioRxiv - Immunology 2020Quote: ... IL-2 and methanol were all purchased from Sigma-Aldrich (St. Louis, MO). Poly(lactide-co-glycolide)-block-poly(ethylene glycol)-succinimidyl ester (PLGA-PEG-NHS ...
-
bioRxiv - Biochemistry 2021Quote: ... NTPs were from Chem-Impex International (Wood Dale, IL) and all other chemical reagents were from Sigma-Aldrich. The pH of Tris-HCl was adjusted at 23 °C.
-
bioRxiv - Bioengineering 2022Quote: ... in medium containing 50 ng/mL IL-6 (Peprotech),10 ng/mL IL-15 and 15 ng/mL interferon-α2B (Sigma-Aldrich).
-
bioRxiv - Immunology 2022Quote: ... IL-10 -/- mice were given streptomycin (5 g/L, Cat#S9137, Sigma-Aldrich) in the drinking water ad libitum for 24 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... HPAECs were treated with 1 ng/ml IL-1β (Millipore Sigma, Catalog# H6291) for 8 hours.
-
bioRxiv - Microbiology 2023Quote: ... Cytokines were detected from vitreous humor using commercial kits IL-1β (Sigma-Aldrich), TNFα (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293-T cells were transiently transfected with GFP-V5 or GREP1-V5 fusion proteins using OptiMem and Fugene HD (Sigma-Aldrich, St. Louis, MO). 72 hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... and SNU1 were transduced using 8 μg/mL hexadimethrine bromide (Sigma), and the media was changed 24 h after transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were adjusted to pH 8 with 1 M Tris (Sigma). NAD+ and NADH levels were determined by fluorescence intensity of resorufin produced by an enzymatic cycling reaction using resazurin (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... and retinas were collected into 300 µl of 8% OptiPrep (Sigma) in Ringers solution ...
-
bioRxiv - Cell Biology 2020Quote: ... All media were supplemented with 8% fetal calf serum (FCS, Sigma). All cell lines were cultured at 37□C and 5% CO2 and routinely tested (negatively ...
-
bioRxiv - Cell Biology 2020Quote: ... - 30 nM in DMSO (c) Caspase 6/8 inhibitor (Sigma, SCP0094) - 40μM in DMSO.
-
bioRxiv - Immunology 2020Quote: ... The slides were fitted with an 8-well module (Sigma-Aldrich) to allow 8 independent assays on each slide ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-β-8-tubulin at 1:500 (Sigma-Aldrich #SAB2700070), mouse anti-Trf1 at 1:250 (Alpha diagnostic international #TRF12-S) ...
-
bioRxiv - Cell Biology 2022Quote: ... the following compounds were added: 8-10 μM oligomycin (Sigma-Aldrich), 10 μM carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP ...
-
bioRxiv - Biochemistry 2019Quote: ... was denatured using 8 M urea (Sigma-Aldrich, St. Louis MO) in 100 mM ammonium bicarbonate (pH 7.4 ...
-
bioRxiv - Biophysics 2019Quote: ... 2 mM MgSO4 (Sigma Aldrich, cat# 63138, CAS:10034-99-8)) with supplements for deficient folate metabolism (50 µg/mL thymidine (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... pH 8) containing 10 mM Reduced L-Gluthatione (Sigma-Aldrich, G6529). The sample was dialysed into TBS overnight and the GST-fusion construct was cleaved using Thrombin (Novagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... we used transwell chambers of 8 μm pore diameter from Millipore. Briefly ...
-
bioRxiv - Plant Biology 2019Quote: ... 0.5% (w/v) polyvinyl pyrrolidone-40 (Sigma Aldrich 9003-39-8) and 0.5% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with heat-inactivated 8% FBS (fetal bovine serum; Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with polybrene (8 μg/mL, H9268, Sigma dissolved in dH2O) for 4 hours ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 mM pH 8 ethylene-diamine-tetraacetic acid (EDTA, Sigma-Aldrich) for 15 minutes ...