Labshake search
Citations for Millipore Sigma :
1101 - 1150 of 10000+ citations for Contactin Associated Protein Like 3 CNTNAP3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... HA tagged proteins were detected in cell lysates using mouse monoclonal anti-HA antibody (Cat# H9658, Sigma, 1:10,000). HA tagged proteins were detected in virus lysates using rabbit polyclonal anti-HA antibody (Cat# H6908 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the equivalent of 500-800 µg of protein was incubated with 1 µg of anti-GFP antibody (Sigma-Aldrich) and then incubated with Protein A/G magnetic beads (Thermofisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... The various 3xF tagged NRPD1 and CLSY proteins were detected using a monoclonal anti-FLAG-HRP antibody (Sigma #A8592). RDR2-eGFP was detected using an anti-eGFP polyclonal antibody68 ...
-
bioRxiv - Neuroscience 2024Quote: ... to perform immunohistochemical procedures in the Penn Digital Neuropathology Lab as described previously.21,61 Immunohistochemistry for neuronal markers included antigen retrieval using citrate buffer and heat for neuronal nuclei protein (NeuN) enriched in most neurons (Anti-NeuN mouse monoclonal antibody, clone A60,1:1000, Millipore) and heavy non-phosphorylated neurofilament (NF-H ...
-
bioRxiv - Cell Biology 2024Quote: ... 3FLAG-6HIS-YFP-tagged proteins expressed from the endogenous locus were immunoprecipitated using anti-FLAG M2 antibodies (F3165, Sigma) (Unnikrishnan et al. ...
-
bioRxiv - Genetics 2024Quote: ... 1mg of cell lysate was incubated with blocked Protein G beads and monoclonal L1 ORF1p antibody (EMD Millipore, MABC1152) at 12 rpm at 4°C overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... An equal amount of protein was used for immunoblot analysis using an anti-HA antibody (1:1000 dilution, Sigma) and anti-cMyc antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein labeling was done by incubation with appropriate primary antibodies as indicated (Supplementary Table S1) in 5% BSA (Sigma) at 4°C overnight ...
-
bioRxiv - Genomics 2022Quote: ... SPA-tagged protein was pulled down from clarified lysates with an anti-FLAG antibody (Sigma-Aldrich, #F1804-1MG, RRID:AB_262044) bound to Protein A-Sepharose beads (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... The ChIP assay was performed with Dynabead Protein G beads and histone antibodies (H3K4me3: Millipore #07-473, H3K4me1: Millipore #07-436 ...
-
bioRxiv - Neuroscience 2023Quote: ... FLAG-BRI2 proteins were immunoprecipitated with anti-FLAG mouse monoclonal antibody M2 cross-linked to agarose beads (Sigma A2220); immunoprecipitated proteins were eluted with 3X FLAG peptide (Sigma F4799) ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified using Amicon Pro Affinity Concentration Kit Protein A with 10kDa Amicon Ultra-0.5 Device (Millipore-Sigma). Antibody concentrations were determined using an IgG ELISA ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA in 50 µL of water was immunoprecipitated with 20 µg/mL anti-protein A antibodies (Sigma Aldrich) and purified by phenol/chloroform extraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the eluted proteins were subjected to Western Blot analysis using a GST antibody (1:1000, Millipore 05-782).
-
bioRxiv - Biochemistry 2022Quote: ... HMCES-3flag protein was detected by immunoblotting with anti-flag antibody (1:10,000 dilution in PBST; Sigma, F1804-200UG) and rat anti-mouse secondary antibody peroxidase conjugate (1:20,000 dilution in PBST ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified using Amicon Pro Affinity Concentration Kit Protein A with 10kDa Amicon Ultra-0.5 Device (Millipore-Sigma). Antibody concentrations were determined using an IgG ELISA ...
-
bioRxiv - Biochemistry 2024Quote: ... and expression of the GFP-tagged protein was verified by western blot using an anti-GFP antibody (Sigma-Aldrich). Colonies with the highest expression for a given construct were used to inoculate 300 mL of YEPD media containing 200 µg/mL Zeocin and grown overnight with shaking (220 rpm ...
-
bioRxiv - Microbiology 2023Quote: ... 4µg of the appropriate antibody and 20µl of Magnetic protein A/G beads (Magnachip, EMD-Millipore, Billerica, MA, USA) were used for the IP step ...
-
bioRxiv - Molecular Biology 2023Quote: The following commercially available antibodies were used to detect targeted proteins: anti-RBM17 (1:1500 dilution; HPA037478, Sigma-Aldrich), anti-SF3B1 (1:3000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were subsequently transferred onto nitrocellulose membranes and immunoblot analysis was performed with following antibodies: HA (Sigma-Aldrich, H6908), FLAG (M2 ...
-
bioRxiv - Plant Biology 2024Quote: ... His- and GST-tagged proteins were detected with anti-His (Monoclonal Anti-polyHistidine antibody, Sigma H1029, 1:5000 dilution) or anti-GST (Mouse anti-GST monoclonal antibody ...
-
bioRxiv - Cancer Biology 2024Quote: ... Detection of specific protein bands was accomplished using a rabbit monoclonal anti-GLRX3 antibody (1:1,000, HPA028941, Sigma-Aldrich), ferritin (1:1,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were detected after incubating with peroxidase conjugated secondary antibodies for 1 hour and 5min with ImmobilonR Western (Millipore) after 5x washes ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Cell Biology 2020Quote: ... The membrane was incubated with the primary antibody for cleaved caspase-3 (ISIS, Cat# 9664) or β-Actin (Sigma, Cat# A-5060) for 2 h at room temperature or overnight at 4o C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10ug nuclear protein was incubated with dsDNA infrared tagged constructs (Table 1. 5’-3’ First strand, IDT, NSW, AUSTRALIA) with or without the additional supershift antiRAGE antibody (1ug, Millipore, CA, USA).
-
bioRxiv - Neuroscience 2019Quote: ... BW723C86 (α-methyl-5-(2-thienylmethoxy)-1H-Indole-3-ethanamine monohydrochloride) and a primary antibody raised against β-actin were purchased from Sigma (USA). Other primary antibodies ...
-
bioRxiv - Immunology 2019Quote: ... blocked with 3% BSA and finally reacted with primary antibodies for phosphotyrosine (Cat No.: 05-321; clone: 4G10; EMD Millipore, Burlington, MA), DAP12 (Cell Signaling Technology) ...
-
bioRxiv - Cell Biology 2020Quote: ... Immunoprecipitations were performed at 4°C for 3 h using 5 µg of an anti-FLAG M2 antibody (Sigma-Aldrich, F1804, mouse). For RIP-Seq ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices with Cav2-Cre injection at MPC and lENT were immunostained by Rabbit anti-Cre antibody (Millipore Sigma, Cat#69050-3) and Donkey anti-Rabbit secondary antibody ...
-
bioRxiv - Developmental Biology 2019Quote: ... gills were washed 3 ×20 min with phosphate-buffered saline (PBS) and then immunostained with anti-bromodeoxyuridine antibody (BrdU, Sigma-Aldrich, Inc.). Therefore ...
-
bioRxiv - Molecular Biology 2019Quote: Immunoprecipitations were set up with 100 µl solubilised chromatin (roughly equivalent to 4 × 106 cells) and 3 µg of an anti-acetylated histone H3 antibody (Millipore, 06-599) in a total of 1 ml Native ChIP Incubation Buffer (10 mM Tris pH 7.5 ...
-
bioRxiv - Microbiology 2019Quote: ... The a-P28 antibody was conjugated with the Cy3 fluorescent dye using the Cy®3 Ab Kit GE Healthcare (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated with Cy-3-conjugated goat anti-rabbit IgG as the secondary antibody (1:500, Cat # AP132C, Millipore Sigma, Burlington, MA) at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were washed 3 times with D-PBSX before incubation with the corresponding secondary antibodies (all diluted 1:500) and DAPI (Sigma, #32670-25mg) for 1 h (RT) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were blocked in 3% BSA for 30 min at RT and incubated with anti-alpha-SMA antibody (1:1000; Sigma, Cat. # A2547) and anti-collagen type I antibody (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... COMMD2 immunoblots were blocked for 1 hr at room temperature in 3% milk TBST and probed overnight at 4°C with the primary antibody (Sigma ref# HPA044190) suspended in 3% milk TBST ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in 1xPBS + 0.5% Tritton X-100 + 3% Bovine Serum Albumin before adding the primary antibody (HPA036814, Sigma-Aldrich – 1/1000) for 48h at 4°C ...