Labshake search
Citations for Millipore Sigma :
951 - 1000 of 2589 citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... To deplete mouse STK3 expression in HMVP2 cells TRC2 MISSION shRNAs in pLKO.1-puro vector backbone were used (Millipore-Sigma). Lentivirus was generated with psPAX2 and pMD2.G packaging plasmids using with the Polyplus jetPRIME transfection kit in 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... or human NUP153-specific shRNA lentivirus particles overnight at 37°C followed by selection in medium containing Puromycin (Puro, 2 μg/ml) (Sigma-Aldrich) for 48 hr ...
-
bioRxiv - Cell Biology 2020Quote: Lentiviral particles were either generated by the laboratory (NF-κB or p53 reporter) or obtained from the MISSION shRNA library (Sigma-Aldrich). These obtained lentiviral particles harbor the following shRNA clones in pLKO.1 backbone vector and were used to infect BJ cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... and RSV-Rev) and a SERPINE1 shRNA construct encoded in a PLKO.1 vector (henceforth called shPAI1: TRCN0000370159, sense: ACACCCTCAGCATGTTCATTG; Sigma-Aldrich). A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864 ...
-
bioRxiv - Molecular Biology 2021Quote: J1 mES cells with doxycycline-inducible short hairpin RNA-micro RNA (shRNA – Supplementary Table 2) sequences targeting Tet1 or Tet3 were treated for 48h with 2 μg/mL doxycycline (D9891, Sigma Aldrich).
-
bioRxiv - Neuroscience 2019Quote: ... Five 15 cm dishes of 70 – 80 % confluent mouse Schwann cells were separately transfected with 30 μg of pLKO.1-puro vector containing five commercial VDAC1 shRNA (Sigma-Aldrich, sh1#TRCN0000012388 ...
-
bioRxiv - Cancer Biology 2019Quote: ... the PDCD4 shRNA oligonucleotides (5‘-CTGGACAGGTGTATGATGTGG-3’) were synthesised and cloned into the MISSION® TRC2 pLKO.5-puro Empty Vector (SHC201, Sigma) by TsingKe Ltd ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (33-35) and selected with 2 µg/mL puromycin (Sigma-Aldrich). To vary glucose concentration ...
-
bioRxiv - Cancer Biology 2020Quote: Using the custom barcodes lentiviral shRNA library, PDX lines (PATC69, PATC124, PATC53 and PATC153) were transduced in vitro using 8 μg/mL Polybrene (Sigma-Aldrich). Libraries were transduced at 1000X coverage and multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (20) and selected with 2 μg/mL puromycin (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral plasmids containing shRNAs targeting STING (shSTING-1 #TRCN0000161345, shSTING-2 #TRCN0000163029) or non-targeted (scrambled) shRNA (shNT #SHC016-1EA) were purchased from Sigma Aldrich. STING-IRES-GFP and DN-IRES-GFP lentiviral plasmids were generated by inserting the cDNA of STING or STING-DN ...
-
bioRxiv - Microbiology 2019Quote: Lentiviral particles carrying an anti-CTIF shRNA were produced in HEK293 cells by transfecting a commercially available pLKO.1 vector containing the shRNA sequence targeting the 3’-UTR of the CTIF mRNA (Sigma-Aldrich), pVSVg and psPax2 ...
-
bioRxiv - Cancer Biology 2021Quote: LCN2 stable knockdown clones were generated in SUM149 or MDA-IBC3 cells by using shRNA (shLCN2-1: TRCN0000060289 from Sigma-Aldrich; shLCN2-2 ...
-
bioRxiv - Immunology 2021Quote: ... pLKO.1 empty vector was from Open Biosystems, and pLKO.1 control shRNA (scramble shSCR, SHC002 and non target shNTgt, SHC016) from Sigma-Aldrich. Lentiviral vectors carrying these constructs were produced by calcium phosphate transfection of 293FT cells with shRNA constructs in combination with packaging vectors psPAX2 ...
-
bioRxiv - Cell Biology 2020Quote: ... TRCN0000073737 5’-CCGGCGCGTTATCAACTGGATCCAACTCGAGTTGGATCCAGTTGATAACGCGTTTTTG-3’ designed and cloned into the lentiviral pLKO.1 puromycin resistant vector Mission shRNA lentiviral Transduction particle (Sigma Aldrich). Control Caco2 clones (shNT ...
-
bioRxiv - Cell Biology 2021Quote: Mission plasmids directing expression of shRNAs targeting PlexinA2 (TRCN0000061499 (ShPlexA2#1) and TRCN0000061501 (ShPlexA2#2)) or PlexinA4 (TRCN0000078683) were purchased from Sigma Aldrich. The production of the lentiviruses ...
-
bioRxiv - Developmental Biology 2022Quote: 300k SV-HUC-1 cells were seeded and transfected with 3µg MISSON pLKO.1-puro non-mammalian targeting control shRNA (Sigma, Cat# SHC002) or shExoc5 (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Scrambled and GAN KO cell lines were generated by transducing SH-SY5Y cells with lentivirus expressing the Mission pLKO.1 backbone for scrambled shRNA (Sigma, #SHC002) and GAN shRNA (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded in 60 mm dishes at 50-60% confluency and transiently transfected with CEP41 shRNA (5’-GCTTACAGTTACCCAATTGCA-3’, TRCN0000143499, Sigma-Aldrich) or scramble shRNA (SHC002 ...
-
bioRxiv - Microbiology 2023Quote: ... Filtered lentiviral supernatant was introduced to MRC5 cells for FLAG-Raf1 experiments or HFF cells for shRNA experiments in the presence of 5 μg/ml Polybrene (Millipore Sigma). Three hours later ...
-
bioRxiv - Neuroscience 2023Quote: ... commercially available lentiviral small hairpin RNA (shRNA) vectors based on the pLKO.1 backbone (s. Key Resource Table; annotated as “transfected”) were purchased from Sigma-Aldrich. To reduce the amount of DNA needed for transfection to perform pHluorin assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the corresponding empty vector (Genecopoeia. MDK silencing was performed by lentiviral-driven expression of shRNAs, with pLKO-constructs purchased from Sigma Aldrich as previously reported16,17,65 ...
-
bioRxiv - Neuroscience 2024Quote: SH-SY5Y cells with doxycycline-inducible TDP-43 shRNA expression were treated with 5 μg/mL actinomycin D (Sigma-Aldrich, A1410) for 0 ...
-
bioRxiv - Immunology 2023Quote: ... A lentiviral vector expressing shRNA against MDA5 to knock down MDA5 expression in CHME-5xISRE-Nluc (see below) was purchased from Sigma (TRCN0000232948). Lentiviral particles were generated by co-transfection of HEK293T cells with lentivectors (pDuet 5xISRE-Nluc ...
-
bioRxiv - Cancer Biology 2023Quote: ... HNT-34 and OCI-AML3 cells were transduced with shRNA-CD81 or non-targeting (NT) shRNA lentiviral vectors (TRCN0000300291[sh291], TRCN0000300293[sh293], TRCN0000300433[sh433] or TRC2 pLKO.5-puro; Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2023Quote: ... To boost the expression of the shRNA constructs the mice were also provided with 25 mg/kg doxycycline hydrochloride (#D3447, Sigma-Aldrich) resuspended in PBS via intraperitoneal injection once a day for the first two days of doxycycline treatment.
-
bioRxiv - Cancer Biology 2024Quote: ... the cells were infected with the lentivirus expressing shRNA or cDNA in the presence of polybrene (5 μg/mL) (Sigma, USA), followed by selection with puromycin (5 μg/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... and MHH-ES-1 cells containing a Dox-inducible shRNA targeting GLRX3 were synchronized by a double thymidine (T1850, Sigma-Aldrich) block/release68 ...
-
bioRxiv - Plant Biology 2019Quote: Plasmid pFLAG-ATS (Sigma) was used for protein expression in this study ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 plasmids (Sigma) encoding shRNA for Sertad4 (TRCN0000247967 and TRCN0000247969 ...
-
bioRxiv - Microbiology 2020Quote: ... pET-32a plasmid (Novagen) was used ...
-
bioRxiv - Microbiology 2023Quote: ... the pET28a plasmid (Novagen) was used ...
-
bioRxiv - Microbiology 2024Quote: Plasmid pSTBlue-1 (Novagen) was used as the vector for routine DNA manipulations ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... the rats in SCI group were received the process of SCI and administrated with normal saline and the rats in SCI+Ex-4 group were administrated intraperitoneally (i.p.) with Ex-4 (10 µg/rat) (Sigma-Aldrich, St. Louis, MO, USA) in normal saline after SCI and dosing interval was 24h for three days ...
-
bioRxiv - Genetics 2021Quote: ... A primary antibody (rat anti-HA, 1:1,000, Sigma, 3F10) was diluted in 5% fetal bovine serum/TBST and the membrane was incubated overnight at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... 1:250 rat anti-myelin basin protein (MBP) (Millipore MAB386); secondary antibodies were Alexa Fluor® conjugates from Life Technologies and used at 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: Cells were plated on rat tail collagen (Sigma-Aldrich, 11179179001) coated glass slides ...
-
bioRxiv - Neuroscience 2019Quote: ... HRP-conjugated secondary antibodies: Goat anti-rat was from Millipore and Jackson Immuno Research ...
-
bioRxiv - Bioengineering 2021Quote: ... rat monoclonal anti-Nicotinic Acetylcholine Receptor (Sigma-Aldrich, 1:800). The following secondary antibodies (diluted in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-Flag rat (Sigma Cat# SAB4200071; 1:500 surface ICC), anti-Myc rat (Abcam Cat# ab206486 ...
-
bioRxiv - Neuroscience 2021Quote: ... type I from rat tail (Cat. No. C3867, Millipore Sigma) at 10 μg/cm2 for two hours in a 37°C incubator ...
-
bioRxiv - Neuroscience 2020Quote: Rats were euthanized with sodium pentobarbital (130 mg/kg; Sigma) and transcardially perfused with PBS to remove blood ...
-
bioRxiv - Cell Biology 2021Quote: ... rat antibody against tyrosinated tubulin (1:100; Sigma Aldrich, MAB1864), and mouse antibody against detyrosinated tubulin (1:100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... briefly rat-tail type I collagen (#08-115, Sigma, Millipore) was prepared to a final concentration of 2.1 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... briefly rat-tail type I collagen (#08-115, Sigma, Millipore) was prepared to a final concentration of 2.1 mg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... rat monoclonal anti-HA (1:800, clone 3F10 Roche/Sigma).
-
bioRxiv - Microbiology 2020Quote: ... and 1:100 rat anti-mouse MLKL antibody (Millipore-Sigma) for MLKL detection followed by treatment with 1:1000 chicken anti-rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:100 rat anti-mouse MLKL antibody (Millipore-Sigma) for MLKL detection followed by treatment with 1:1000 chicken anti-rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-HA clone 3F10 (diluted 1:3000, Sigma #2158167001), mouse anti-GAPDH clone 6C5 (diluted 1:3000 ...
-
bioRxiv - Plant Biology 2021Quote: ... and rabbit anti-rat-peroxidase A9542 (1:20000, Sigma-Aldrich) with SuperSignal West Dura Extended Duration Substrate (Thermo Scientific).