Labshake search
Citations for Millipore Sigma :
9151 - 9200 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and mixed with 20 μL of 0.15% 3-hydroxydiphenol (Sigma) in 0.5% NaOH ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DNase I (#69182–3; Sigma Aldrich, 10 U/ml) for 2 hours at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... and 3 µM Dorsomorphin (Sigma Aldrich, Saint Louis, MO, USA) for 24 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... 3% v/v heat-inactivated Human Male AB Serum (Sigma), 2 mg/ml Human Serum Albumin (HSA ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit polyclonal antibody to GluR2/3 (1:100; #AB1506; Millipore) or a rabbit polyclonal antibody to NPY (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... *Rabbit anti-caspase 3 active cleaved (1:1000, AB3623, Millipore).
-
bioRxiv - Plant Biology 2024Quote: ... or 3 μM methyl viologen dichloride hydrate (MV, Sigma-Aldrich). Treatments were performed for 24 h under the same growth conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... in 3% v/v aqueous acetic acid (A6283, Sigma-Aldrich) solution for 5 minutes ...
-
bioRxiv - Physiology 2024Quote: ... stimulated with nicotine (Sigma Cat. # 6019-06-3, 50μg/ml), nicotine + angiotensin II (Tocris Cat ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 mM 3-mBz (m-toluic acid, Sigma-Aldrich) to induce msfGFP production ...
-
bioRxiv - Genomics 2024Quote: ... 3) 30 seconds in Harris’ modified Haematoxylin solution (Sigma HHS16), 4 ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by coating with 3 mg/ml Concanavalin A (Sigma) for 1 hour at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... 50mg 3-(Acrylamido) phenylboronic acid (Sigma Aldrich Cat No. 771465), 1ml 10X RNase-free TAE ...
-
bioRxiv - Cell Biology 2024Quote: ... the substrate was treated with (3-Aminopropyl) triethoxysilane (Sigma-Aldrich), diluted at 5% in absolute ethanol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3% bovine serum albumin (w/v) (Sigma, A-7888) at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were blocked with 3% donkey serum (Millipore Sigma, D9663) in PBS for 2 hours at room temperature and incubated overnight at 4°C using the following concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μL of 3 mg/mL Collagenase (Sigma-Aldrich, C6885) was added to the supernatant and the mixture was incubated at 37°C for 45 minutes under constant shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking with a 3% goat serum (Sigma-Aldrich – S26) solution in PBS for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... using 3:1 polyethylenimine (average Mw, ∼25,000 Da; Sigma-Aldrich) to total DNA ratio (4 μg BRSK and 2 μg TAU DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 µM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich #I5879), and 1 µM dexamethasone (Gbiosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phase separation was achieved with 1-bromo-3-chloropropane (Sigma), and the resulting aqueous phase was precipitated in isopropanol ...
-
bioRxiv - Biophysics 2024Quote: ... 500 mM 3-(1-Pyridin)-1-Propansulfonat (NDSB-201; Sigma) for protein stabilisation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and blocked (3% BSA (Bovine Serum Albumin, Sigma-Aldrich #A7030) and 0.1% Tween (Sigma-ldrich)) ...
-
bioRxiv - Cancer Biology 2024Quote: 3% poly-2-hydroxyethyl methacrylate (poly-HEMA; P3932, Sigma-Aldrich) solution was prepared in 95% absolute ethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μM Nigericin (Sigma-Aldrich, N7143, CAS: 28643-80-3), 2.5 μM Saliphenylhalamide (Salip ...
-
bioRxiv - Neuroscience 2024Quote: D-4-amino-3-isoxazolidone (DCS, C3909 Sigma-Aldrich, UK) was prepared in sterile saline solution (6) ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 purchased from Sigma Aldrich, MO ...
-
bioRxiv - Neuroscience 2024Quote: ... permeabilized for 30 min with 3% Triton-X (Millipore Sigma) in 1x PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... and phase-separated in 1-bromo-3-chloropropane (B9673, Sigma) [82,95] ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by endogenous peroxidase inactivation with 3% H2O2 (Sigma-Aldrich) and subsequently blocked in 5% BSA in TBS-T with TBS washes inbetween each step ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM DTT supplemented with 3 mM ATP (Sigma) and 3 mM MgCl2 ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Immunology 2024Quote: ... 0.3% Triton X-100 and 3% Bovine Serum Albumin (Sigma). Cells were stained with antibodies for 30m-1h at room temperature or up to overnight at 4°C ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and IBMX (3-Isobutyl-methylxanthine, 25µM, Sigma-Aldrich, Toluca Mexico) with ACSF was perfused for 25min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 mM MgCl2) containing 250 U/ml Benzonase (Sigma, E1014), 1X cOmplete EDTA-free protease inhibitor cocktail (Roche ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently washed 3 times with PBS 2% FBS (Sigma). pDCs were enriched from freshly isolated PBMCs using the human Plasmacytoid Dendritic Cell Isolation Kit II (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2024Quote: ... a 2% 3-(Trimethoxysilyl)propyl methacrylate (TMSPMA, Sigma-Aldrich 440159) (v/v ...
-
bioRxiv - Immunology 2020Quote: ... and product intensity measured by Software ImageJ(83) and normalized to ACTIN amplicon products (5’-GACGACATGGAGAAAATCTG-3’ and 5’-ATGATCTGGGTCATCTTCTC-3’, Sigma-Aldrich, St. Louis, Missouri, USA).
-
bioRxiv - Neuroscience 2021Quote: ... FW 5’ – CCA CAT GGG AGA GTC ACA T −3’ and RV 5’-ATA GCC TGG AAG CGG TCA GAT G −3’ (Sigma-Aldrich Japan, Inc., Tokyo, Japan). The PCR products (521 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... BrdU injections were done 24h before sacrifice for the analysis at 3 dpKA and 3/7 days post administration of zinc (Cat#83265-250ML-F, Sigma-Aldrich, St Louis, MO, USA). To identify newborn cells at 14 dpKA ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(1H-Indol-3-yl)-4-oxo-4-phenyl-butyric acid (PEO-IAA; OlChemIm, Olomouc, Czech Republic) and indole-3-carbinol (I3C; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Microbiology 2020Quote: ... the membrane was incubated at 4°C o/n with the monoclonal anti-flag M2 primary antibody (Sigma Aldrich) in TBS-T buffer containing 5% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... The pellet was washed once with buffer A and then resuspended in 10 mM Tris-HCl pH 7.5 + 0.1% N-lauroyl-sarcosin (Sigma-Aldrich) and Complete Protease Inhibitor Complete (buffer B) ...
-
bioRxiv - Biophysics 2021Quote: ... Gelsolin TL40 (N-terminal cytoplasmic gelsolin, Hypermol, Germany) was covalently bound to carboxylated microspheres (0.9 µm diameter, Sigma Aldrich) with 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide in order to bind the +end of a single actin filament ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells’ membranes was lysed by adding 1 volume of the 2x Lysis Buffer (Buffer N supplemented with 0.6% NP-40 substitute (Sigma)) to the single cell suspension resuspended in 2 PCVs (packed cell volumes ...
-
bioRxiv - Neuroscience 2020Quote: ... we selected pentyl acetate (PA; also known as amyl acetate or n-amyl acetate; Sigma-Aldrich, cat no. 109584). EA and PA are homologous esters that differ by a length of three carbons ...
-
bioRxiv - Physiology 2022Quote: ... The glucose content of the supernatant was measured using hexokinase (catalog n° H4502, Sigma-Aldrich, Saint-Louis, MO, USA) and glucose-6-phosphatase enzyme (catalog n°G8404 ...
-
bioRxiv - Neuroscience 2021Quote: Antibodies and dilutions were as follows: Anti-HNK-1 antibody (Sigma Aldrich, Monoclonal Anti-HNK-1/N-CAM (CD57), # C6680) ...
-
bioRxiv - Molecular Biology 2020Quote: Yolk sacs were dissected from embryos and used for DNA extraction with the Red Extract-N-Amp kit (Sigma). Usp9x status was assessed by PCR using Phire Green Hot Start II PCR Master Mix (Thermo Fisher Scientific) ...