Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for 6 1 Aminoethyl 2H 1 4 benzoxazin 3 4H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 100µM 3-Isobutyl-1-methylxanthine (Sigma, Cat#I5879), 100µM 8-bromoadenosine 3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 250 μM 3-isobutyl-1-methylxanthine (Sigma-Aldrich), 100 μM indomethacin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 3 mg ml-1 collagenase A (Sigma) and 1.5 mg ml-1 trypsin (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mixed with 1-bromo-3-chloropropane (Sigma Aldrich) and incubated for 10 min ...
-
bioRxiv - Microbiology 2019Quote: ... 3 μl of 1 M dithiothreitol (Sigma-Aldrich) and mechanical disruption ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... (3) ChIP lithium buffer containing 1% Igepal (Sigma), 1mM EDTA ...
-
bioRxiv - Immunology 2019Quote: ... with 3 mg/ml collagenase type 1 (Sigma) and 1.5 mg/ml trypsin (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... 500 μM 3-isobutyl-1-methylxanthine (Sigma Aldrich) and 200 μM indomethacin (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2019Quote: ... 500 μM 3-isobuthyl-1-methylxanthine (Sigma Aldrich) and 200 μM indomethacin (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2019Quote: ... (iv) 3 hours of 2000kU DNase-1 (Sigma) in 1M NaCl (for human tissue ...
-
bioRxiv - Physiology 2020Quote: ... 0.5mM 3-Isobutyl-1-methylxanthine IBMX (Sigma Aldrich), 1μM dexamethasone (Sigma Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.5 mM 3-Isobutyl-1-methylxanthine (Sigma-Aldrich), and 2.5 μg/ml insulin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2019Quote: ... 1% (v/v) phosphatase inhibitor cocktail 3 (Sigma), 20µM MG132 ...
-
bioRxiv - Cell Biology 2019Quote: ... Par-3 antibody (Millipore, 07-330, 1:200), ZO-1 antibody (Life Technology ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-CRE (Millipore, 69050-3, diluted 1:1000); Anti-TBX1 (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 μl 1-Bromo-3-chloropropane (Sigma-Aldrich) was added to the RNAsolv ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 μM 3-isobutyl-1-methyxanthine (Sigma Aldrich), 1μM pioglitazone (provided by AZ) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-NEUN (Fox-3; Millipore ABN91; 1:500), anti-C1Q (Abcam ab182451 ...
-
bioRxiv - Physiology 2022Quote: ... 3-isobutyl-1-methylxantine (IBMX, Sigma, cat# 17018), isoproterenol hydrochloride (Tocris Bioscience ...
-
bioRxiv - Biophysics 2024Quote: ... a 3:1 BrdU/BrdC mix (Sigma-Aldrich, #B5002 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 µg/ml laminin (all 3 Sigma, USA). During terminal differentiation ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Millipore Sigma), and 1 µg/ml insulin (Millipore Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-isobutyl-1-methylxanthine (IBMX, 0.5mM, Sigma Aldrich), and dexamethasone (1μM ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% Phosphatase Inhibitor Cocktail 2 and 3 (Sigma), and 10 mM sodium butyrate) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-butanol (CAS #71-36-3, Millipore Sigma), ethyl lactate (CAS #97-64-3 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CGRP (Sigma, #PC205L, 1:800, 3 days), anti-β-III tubulin (Cell Signaling ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 µg mL-1 aphidicolin (Sigma Aldrich, A0781) was added to the cells to arrest them at the G1/S boundary ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% phosphatase inhibitor cocktail 3 (Sigma-Aldrich P0044), 1X PBS ...
-
bioRxiv - Genetics 2023Quote: ... 1% phosphatase inhibitor cocktail 2 and 3 (Sigma) and 2% protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-IBA4 (Sigma, #L2140, 1:800, 3 days), anti-CGRP (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 150 μl 1-Bromo-3-chloropropane (Sigma Aldrich) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1-Bromo-3-chloropropane (Sigma-Aldrich # B9673) extraction ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...