Labshake search
Citations for Millipore Sigma :
5701 - 5750 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: 6 x 105 cells were added into the wells of a 96 well filter plate (MSHVS4510 Millipore MultiScreenHTS HV Filter Plate ...
-
bioRxiv - Biochemistry 2019Quote: ... Labeled viruses were further purified by ultracentrifugation at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient for 1 hour.
-
bioRxiv - Microbiology 2019Quote: ... Cells were prepared in 6-well plates precoated with laminin (10 mg/ml; catalog number L2020; Sigma) and were grown to near confluence (80 to 90% ...
-
bioRxiv - Microbiology 2019Quote: ... Cell lysates were incubated 45 min at 37 °C with 0.6 mg.mL−1 fructose-6-phosphate (Sigma) and 0.6 mg.mL−1 glutamine (Sigma) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and used to transduce cells in the presence of 6 μg/mL polybrene (Sigma, St. Louis, MO).
-
bioRxiv - Physiology 2019Quote: Limbs from Mig-6 over/over and control mice were harvested and fixed in 4% paraformaldehyde (Sigma) for 24 hours and decalcified in ethylenediaminetetraacetic acid (5% EDTA in phosphate buffered saline (PBS) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI, 1 µg/ml, Sigma-Aldrich). Sections were coverslipped using Vectashield Antifade Mounting Medium (Vector Labs ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were plated into 6 well plates coated with >300,000 MW Poly D Lysine (PDL; Sigma, P7405). After 7 DIV ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-Glutamine Synthetase (for Müller glia-specific marker; 1:5000 Millipore #MAB302, clone GS-6); goat polyclonal anti-Brn3a (for retinal ganglion cell marker ...
-
bioRxiv - Biochemistry 2020Quote: ... for 20 min and optionally counterstained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole, Sigma) nucleic acid stain ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were stripped by two 7 min incubations in stripping buffer (6 M guanidine hydrochloride (Sigma: G3272) with 1:150 β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... The biotinylation reaction was quenched by 3 washes of a stop solution prepared with 10 mM 6-Hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Sigma), 20 mM sodium Ascorbate and 10 μM sodium azide in PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... the eIF4EWT and eIF4EKI mice (6-8 weeks old) were treated with 2 μl 4-HT (Sigma) at 5 mM working concentration for 3 continuous days ...
-
bioRxiv - Cell Biology 2021Quote: ... 300 μl of the supernatant was mixed 1:1 with 6% (w/v) sulfosalicylic acid (Sigma-Aldrich) in milliQ water ...
-
bioRxiv - Cell Biology 2021Quote: NFIC expression was interfered in 266-6 cells using Mission shRNA lentiviral constructs purchased from Sigma-Aldrich. Nfic sh1 [TRCN0000374154 targeting ACAGACAGCCTCCACCTACTT) ...
-
bioRxiv - Neuroscience 2020Quote: ... and counter-stained using 4’,6-diamidino-2-phenylindole (DAPI) for nuclei (Sigma, D9542-10MG, 1:1000). Confocal images of the cortex of non-transgenic littermates and arcAβ mice were obtained using a Leica SP8 confocal microscope (Leica Microsystems GmbH ...
-
bioRxiv - Genomics 2021Quote: ... we harvested EBs and moved them to an ultra-low attachment 6-well plate (CLS3471-24EA, Sigma) in E6 media (A1516401 ...
-
bioRxiv - Microbiology 2019Quote: ... For each strain 60 µl lysate were incubated with 6 µl amyloglucosidase (200 U/ml, Sigma-Aldrich) (quantification of glucose stored as glycogen and free glucose ...
-
bioRxiv - Microbiology 2021Quote: ... samples were treated with 10 μg/mL of 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclear DNA was stained with DAPI (4’,6’-diamidino-2-phenylindole) (0.1 µg/ml; Sigma-Aldrich, Poland). Immunostained cultures were mounted on glass slides in ProLong Gold antifade medium (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Culture medium was changed 6 h after transfection and supplemented with 10 μM 9-cis-retinal (Sigma) for experiments with light-activated receptors ...
-
bioRxiv - Molecular Biology 2021Quote: ... Culture medium was changed 6 h after transfection and supplemented with 10 μM 9-cis-retinal (Sigma) for experiments with light-activated receptors.
-
bioRxiv - Neuroscience 2020Quote: ... followed by 6×10 min washes in PBX (PBS with 0.3% Triton-X 100 [Sigma-Aldrich, T8787]) at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 wells) in 1 ml of media in 24-well plates coated with poly-HEMA (Sigma P3932) to inhibit cell adherence ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen retrieval was performed by microwaving sections in preheated 0.01 M citrate buffer pH 6 (Sigma Aldrich) for 5 min.
-
bioRxiv - Cell Biology 2020Quote: ... Islets were isolated from 6-12 week old male and female FVB mice using collagenase XI (Sigma) digestion according to a previously published protocol101 ...
-
bioRxiv - Cell Biology 2021Quote: ... Slides were inserted into a 1 μg/ml solution of 4’,6-diamidino-2-phenylindole (DAPI, Sigma) for 10s and ...
-
bioRxiv - Biophysics 2022Quote: ... (6)) by using anti-Flag coupled beads (Pierce, #A36797) for Src precipitation and anti-Flag (M2, Sigma) and anti-Myc (9B11 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse monoclonal antibodies: anti-acetylated α-tubulin (AcTub) (Sigma, T7451, clone 6-11B-1, IF: 1:10,000), anti-α-tubulin (Proteintech ...
-
bioRxiv - Immunology 2022Quote: ... as the mobile phase on the Superose 6 Increase 10/300 GL (Millipore Sigma, 29-0915-96). Fractions were analyzed by SDS-PAGE to identify those containing gH/gL >95% purity based on Coomassie blue staining ...
-
bioRxiv - Cell Biology 2022Quote: ... contained in a 6-well plate were coated with poly-D-lysine (50 ng/ml, Sigma, P6407) for 1-2 h at 37°C after which the poly-D-lysine was removed ...
-
bioRxiv - Developmental Biology 2022Quote: ... a mouse monoclonal anti-acetylated tubulin clone 6-11B-1 antibody (IgG2b; product T 6793; Sigma-Aldrich) were used at 1:2,500 dilution and secondary anti-mouse isotype-specific antibody conjugated with Alexa 488 (anti-IgG2b ...
-
bioRxiv - Cell Biology 2022Quote: ... nuclei were counterstained with 500 ng/mL of 4′,6-diamidino-2-phenylindole (DAPI, Sigma, CAT#D8417) for 10 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... then dehydrated through a PBS/methanol gradient and bleached with 6% (vol/vol) hydrogen peroxide (H1009, Sigma) in methanol overnight at 4° C ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were stained with DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich Corp., St. Louis, MO, USA) and cover slipped with Fluoromont-G ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded in 6-well plate (100,000 to 150,000) and infected in the presence of 8μg/ml polybrene (Sigma). Cells were selected in medium containing 3μg/ml puromycin (Sigma ...
-
bioRxiv - Biophysics 2020Quote: Unsized unilamellar DOPG liposomes containing Laurdan (6-Dodecanoyl-N, N-dimethyl-2-naphthylamine, from Sigma, Taufkirchen, Germany) (molar ratio lipid:Laurdan=1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were washed 1x and incubated with 0.2µg/mL DAPI (4’,6-diamidino-2-phenylindole, Sigma-Aldrich) for 10min at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 6 μg of female-derived competitive DNA and 50 µg of sonicated salmon sperm DNA (Sigma-Aldrich). Each ethanol-precipitated probe mixture was dissolved in 20 μL of the hybridization buffer (for composition ...
-
bioRxiv - Cancer Biology 2022Quote: ... A methylcellulose stock solution was prepared by dissolving 6 grams of autoclaved methylcellulose powder (M0512 Sigma-Aldrich) into 250 ml of preheated (60°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 weeks old mice in the 4NQO group were given 100ug/ml of 4NQO (Sigma-Aldrich, #N8141), a water soluble chemical carcinogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... native fluorescence was quenched after immunostaining by overnight incubation with methanol containing 6% hydrogen peroxide (H1009, Sigma) at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... adult (6-8-wk-old) Lrig1-CreERT2/+;Apc-flox/+ mice were intraperitoneal-injected with 2mg tamoxifen (Sigma) in corn oil for 3 consecutive days ...
-
bioRxiv - Systems Biology 2019Quote: ... Slides were dried for 6 min and subsequently incubated at room temperature with Wright stain (Sigma-Aldrich) for 8 mins ...
-
bioRxiv - Immunology 2019Quote: ... Then cells were stained with a 1/15000 dilution of 4’,6-diamidino-2-phenylindole (DAPI) (Sigma) and mounted in antifading agent Citifluor AF1 (Citifluor Ltd.) ...
-
bioRxiv - Bioengineering 2020Quote: ... as-synthesized mesoporous silica nanoparticles (AMS-6) were loaded with 20% Dox (Doxorubicin hydrochloride, #D1515, Sigma-Aldrich). Dox diluted in 100% ethanol was added to AMS-6 nanoparticles in a round bottom flask mounted on a rotary evaporator ...
-
bioRxiv - Bioengineering 2020Quote: ... the glass fiber capture membrane was submerged for 6-8 hours in trifluoroacetic acid (TFA, Sigma-Aldrich), and dried at room temperature overnight before assembly ...