Labshake search
Citations for Addgene :
1 - 50 of 66 citations for p53 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... shRNA knockdown of p53 (#27077; Addgene); Sox2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pSLIK p53(R280K)-V5 hygro (Addgene #136540) and pSLIK 3xFLAG-CHEK2 neo (Addgene #136536).
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μg of pX330-p53 (Addgene 59910), and 2.5 μg of CMV-SB13 transposase ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2xU6:p53/tyr gRNA mitfa:Cas9 (Addgene #118844) are published (tyr gRNA= GGACTGGAGGACTTCTGGGG ...
-
bioRxiv - Microbiology 2023Quote: ... the pIRES2-EGFP-p53 WT Plasmid (Addgene, #49242)
-
bioRxiv - Cancer Biology 2021Quote: ... Flp-In 3T3 p53-/- cell line was generated by Crispr/Cas9 by co-transfecting Flp-In 3T3 cells with px330 p53 plasmid (Addgene Plasmid #59910) expressing Cas9 and sgRNA targeting mouse p53 and pmaxGFP plasmid (Lonza) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The p53-GFP backbone was purchased from Addgene (11770) (p53-GFP was a gift from Geoff Wahl (Addgene plasmid #11770)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the p53-GFP backbone was purchased from Addgene (11770) (p53-GFP was a gift from Geoff Wahl (Addgene plasmid #11770)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... p53 and Smad4 were cloned into PX330 plasmid (Addgene#42230) and transiently transfected into the KrasG12D tumoroids ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Biochemistry 2021Quote: The full-length FOXO4 and p53 genes were acquired from Addgene. FOXO4 FHD (95-195 ...
-
bioRxiv - Cancer Biology 2019Quote: ... (12091) (GFP-p53 was a gift from Tyler Jacks (Addgene plasmid #12091))[29] ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the p53-GFP backbone was purchased from Addgene (11770) (p53-GFP was a gift from Geoff Wahl (Addgene plasmid #11770)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The p53-GFP backbone was purchased from Addgene (11770) (p53-GFP was a gift from Geoff Wahl (Addgene plasmid #11770)) ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2.5 μg pCMV-Neo-Bam p53 R248W vector (plasmid 1647; Addgene, Watertown, MA) containing the ampr gene was diluted in 500 μL Opti-MEM Reduced Serum Medium in an Eppendorf tube ...
-
bioRxiv - Cell Biology 2020Quote: ... or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID: 19119) (36) ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids encoding p53-WT-EGFP was a gift from Tyler Jacks (Addgene #12091). All mutant constructs used in this study were generated from this construct either by a QuickChange II XL kit (Stratagene ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (wt p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442). The DNA polymerase used was Phusion High Fidelity (cat# E0553S ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Subsequently a 0.737 kb region from pIRES2-mCherry-p53 deltaN (Lin et al., 2013, Addgene), containing the mCherry-coding segment and part of the IRES ...
-
bioRxiv - Cancer Biology 2023Quote: ... wild type TP53 cDNA was amplified from p53-GFP plasmid (Cat #11770) (Addgene, Cambridge, Massachusetts, USA) and cloned into pFN21A (Promega Corporation ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... or vector containing the dominant negative TP53 construct (pBABE-hygro p53 DD, Bob Weinberg, Addgene plasmid #9058) into the clonal MCF10-2A TetOn-CENPA-FLAG-HA cell line by lentiviral transduction ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442; http://n2t.net/addgene:16442; RRID: Addgene_16442). Cells were transfected with Lipofectamine LTX and plus reagent or Lipofectamine 2000 (Thermo-Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ptch;p53 primary cell-line(#4954) was transduced using viral particles containing the lentiCas9-Blast vector (Addgene, Watertown, MA; RRID:Addgene_52962). Cells stably expressing Cas9 were selected using 10ug/ml Blasticidin S HCl (Gibco™-#R21001) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and p53(R280K)-V5 PCR amplicon was prepared with SpeI and MfeI restriction sites and cloned into pEN_TTmiRc2 (Addgene #25752) digested with SpeI and MfeI (Addgene #136520 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ptch;p53 primary cell-line(#4954) was transduced using viral particles containing the lentiCas9-Blast vector (Addgene, Watertown, MA; RRID:Addgene_52962). Cells stably expressing Cas9 were selected using 10ug/ml Blasticidin S HCl (Gibco™-#R21001) ...
-
bioRxiv - Immunology 2022Quote: ... and for human p53 (sgRNA: 5’-GCATCTTATCCGAGTGGA-3’) was already cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0 (Addgene plasmid #62988)) and kindly provided by Daniel Hinze from the lab of Michael Hölzel ...
-
bioRxiv - Cancer Biology 2020Quote: ... The single-guide RNAs targeting G9a and p53 listed in Table S5 were cloned into lentiGuide-Puro (a gift from Feng Zhang, Addgene #52963). For knockdown of RIPK3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in which we cloned a gRNA targeting the genomic p53 sequence: TATCTGAGCAGCGCTCATGG as described by the cloning protocol provided by Addgene (#87360). Organoids were broken up into single cells using a 40 min incubation (37°c ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... separated by a P2A self-cleaving peptide (Addgene ID NK676).
-
bioRxiv - Molecular Biology 2024Quote: ... # 48076) and a transit peptide (in plasmid pICH78133; Addgene # 50292) to target the biosensor to the nuclei and chloroplast stroma respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... TP53DN(R175H)-CFP was constructed by cloning CFP from mitoCFP plasmid into AgeI site of p53 (dominant negative R175H mutant)-pcw107-V5 (Addgene Plasmid #64638 (Martz et al. 2014)) ...
-
bioRxiv - Neuroscience 2023Quote: ... the signal peptide (0-26 amino acids) of pro-opiomelanocortin (#176704, Addgene) and ectodomain (52-750 amino acids ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SunTag (24 x GCN4 peptides) was PCR amplified from the plasmid pcDNA4TO-24xGCN4_v4_sfGFP (Addgene #61058) (Tanenbaum et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... Plasmid pN_35S/CTP-mCitrine was produced in an earlier study [41] and encodes an mCitrine fluorescent protein fused in-frame to the chloroplast transit peptide from RuBisCO small subunit 1A (www.addgene.org, plasmid #117989 (RRID:Addgene_117989)) ...
-
bioRxiv - Plant Biology 2020Quote: ... the Hip1 sequence was amplified without signal peptide and cloned into the pET28a (+) expression vector (Addgene, USA), eventually having a His-tag at the N-terminus ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sequences described above were cloned in frame with the signal peptide NLS (in plasmid pICH86988; Addgene (www.addgene.org) # 48076 ...
-
bioRxiv - Biochemistry 2020Quote: ... and substrate domain (i.e., WMEDYDYVHLQG, a peptide derived from p130cas)—from its parent plasmid (a Kras-Src FRET biosensor, Addgene), (ii ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid was created by adding the rtTA with a 2A peptide to the Puromycin resistance gene in a CMV Puro DEST plasmid (Addgene) by gibson cloning41 ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified and cloned red shifted Luc gene downstream of MNDU3 promoter and linked via 2A peptide to florescent protein encoding gene which were amplified from Addgene plasmids 48249 (mWasabi) ...
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...