Labshake search
Citations for Addgene :
1 - 50 of 976 citations for bta mir 486 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... primary miRNAs for miR-29a and miR-16 were amplified from genomic DNA by PCR and cloned into the pAdTrack shuttle (Addgene, Plasmid#16404). The miR-16 pAdTrack plasmid was then mutated by site-directed mutagenesis to induce 3 point mutations into the miR-16 seed sequence ...
-
bioRxiv - Bioengineering 2023Quote: ... miR-92a (Addgene #46672), let-7a (Addgene #51377 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Two DNA fragments were independently amplified with two primer sets (NLS_Fw1/Rv1, NLS_Fw2/Rv2) using pDest_pK7WG2_pRPS5A_CTP OleGFP (Addgene #171723) as a PCR template ...
-
bioRxiv - Genomics 2022Quote: ... The PCR primers and conditions are available from Addgene. The PCR product were mixed and cleaned using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: pSIN-Clover-Puro and pSIN-Clover-miR-497-Puro were generated from the modified pSIN-Puro backbone utilizing pre-miR-497 cloned from the pMSCV-PIG-miR-497/miR-195 (Addgene #64236, a gift from Joshua Mendel17). Doxycycline-inducible shRNAs targeting Renilla and Vat1 were generated in LT3GEPIR61 (gift from Johannes Zuber ...
-
bioRxiv - Microbiology 2022Quote: ... SECN23A was amplified from pKK29 with the primer set pUC19SECN23AptF/pUC19SECN23AptR and inserted by Gibson Assembly into pUC19 (RRID:Addgene_50005) linearized with KpnI and EcoRI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a Platinum Gate TALEN assembly vector with this RVD, two DNA fragments were independently amplified with primer sets (RV_Fw1/Rv1, RV_Fw2/Rv2) and p1HD (Addgene #50664) as a PCR template ...
-
bioRxiv - Molecular Biology 2019Quote: ... the miR-141 indicator is from Addgene (#67632). To generate 3’UTR luciferase reporters for BCL6 ...
-
bioRxiv - Bioengineering 2023Quote: CHO cells were electroporated with 2 μg of plasmids containing the primary or a fragment of the primary microRNA sequences of three miRs that were in high abundance in standard or stressed cultures (miR-21 (Addgene #21114), miR-92a (Addgene #46672) ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Immunology 2023Quote: ... The wzm – wbbO PCR product was assembled with PCR-linearized pBBR1MCS2 plasmid (Addgene, primers pBBR1-1F/pBBR1-1R) using an NEBuilder HiFi DNA Assembly kit (NEB) ...
-
bioRxiv - Biophysics 2019Quote: ... The LRRK2 gene was cloned by using the primer sets: 5’-GCGATAACATGGCTAGTGGCAGC-3’ and 5’-GGGGTTATGCTAGTTACTCAACAGATGTTCGTCTC-3’ with pENTR221-LRRK2 (Addgene #39529) as the template ...
-
bioRxiv - Bioengineering 2022Quote: ... The hU6 promoter fragment was generated by amplifying the U6 promoter with primer set AA-MluI-U6-gib-FW/AA-U6-sg1-scaf-short-RV from the plasmid backbone pSI-359 (Addgene 131131) and the dsRed filler fragment was generated by amplifying a portion of the dsRed gene from CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA (Addgene 55201 ...
-
bioRxiv - Molecular Biology 2022Quote: ... we first amplified the cassettes including sgRNA using the primer set priEK-35 and priEK-37 from the CRISPRi-V2 library (Addgene #1000000093) using Phusion polymerase (New England Biolab ...
-
bioRxiv - Molecular Biology 2024Quote: Two separate guide sequences targeting the miR-142 locus (SgID #10024 and #10033) from the pLX-miR pool (32) were cloned into vector pBA904 (Addgene Plasmid #122238). MutuI cells were transduced with lentiparticles derived from pCW-Cas9-Blast (Addgene Plasmid #83481 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cloned into a pINDUCER11 miR RUG (Addgene # 44363) backbone (49) ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Cell Biology 2021Quote: LAMP1-GFP was amplified using PCR (using primers listed in Table S2) from Addgene plasmid #34831 and then cloned into lentiviral vector FUGW (Addgene plasmid #14883 ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Genomics 2019Quote: ... The minimal promoter and luciferase insert was prepared using biotinylated PCR primers (Amp_minPLuc2_Biotin_For and Amp_minPLuc2_Biotin_Rev) corresponding to pMPRAdonor2 (Addgene plasmid #49353) and Kapa HiFi HotStart ReadyMix (Kapa Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: LSSmKate2 and mBeRFP were individually amplified by PCR with specific primers from pLSSmKate2-N1 (Addgene #31867) and LK1-MpEF1+mBeRFP+Nos-T35S-T (gift from F ...
-
bioRxiv - Molecular Biology 2020Quote: ... crassa genomic DNA with primers 598 and 599 by PCR and inserting the PCR product into the SpeI site of Plasmid 43802 (Addgene, DiCarlo et al. 2013). The resulting plasmid was used as the template for PCR-based amplification of tef-1(P)-cas9Hs with primers 610 and 589 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was used (Set A, AddGene 92379)29 ...
-
bioRxiv - Molecular Biology 2019Quote: Primers used for PCR amplification of vector inserts from existing plasmids (pL451, tdTomato, AAV from Addgene plasmid# 60229).
-
bioRxiv - Neuroscience 2020Quote: Primers containing linkers attached to each target without the PAM sequence were used for PCR with pCFD4 (RRID:Addgene_49411) as a template ...
-
bioRxiv - Cell Biology 2023Quote: ... were created via PCR amplification (see primer list) and assembled into a Spe-1 digested pCFJ151 (Addgene #19330) vector using isothermal assembly (Gibson et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The TIS11B coding sequence was amplified from pcDNA3.1-puro-GFP-TIS11B using TIS11B MCP F and TIS11B MCP R primers and the TIAL1 coding sequence was PCR amplified from pFRT_TO_FlagHA_TIAL1 (Addgene 106090) using TIAL1 MCP F and TIAL1 MCP R primers.
-
bioRxiv - Biochemistry 2021Quote: pGN002: The ECFP encoding fragment was amplified by PCR using primers GNCA005 and GNCA006 (on pcDNA3-CFP, Addgene #13030), followed by DpnI treatment ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the mutated miR-15amut_16-1mut cluster and a construct encoding Cas9 (Addgene #52962).
-
bioRxiv - Microbiology 2023Quote: The miRNA over-expression plasmids and miR-92a mutation/deletion plasmids were obtained from Addgene vector repository ...
-
bioRxiv - Bioengineering 2023Quote: ... containing the primary or a fragment of the primary miR sequences were obtained from Addgene as stab cultures ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Microbiology 2024Quote: ... 782 bp PCR product obtained with primers ymCherryU and ymCherryL and pAG426-GAL-ccdb-ymCherry (a gift from Susan Lindquist (Addgene plasmid # 14155 ...
-
bioRxiv - Cell Biology 2022Quote: ... 2018 (Dolcetto CRISPRi library set A, Addgene #92385). This library contains 57,050 sgRNA ...
-
bioRxiv - Bioengineering 2021Quote: ... nanobody sequences were PCR amplified with primers containing terminal regions of homology for cloning into a pRset plasmid (Addgene plasmid 3991)(Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... 3356 bp upstream of the RPT2 start codon were amplified by PCR with primers 13Rb-RPT2F and 13Rb-RPT2R and cloned into the AL13Rb plasmid (Addgene # 161006) (Alamos et al. ...
-
bioRxiv - Neuroscience 2022Quote: pFUGW-NLS-FlpO was created using a PCR reaction for NLS-FlpO with primers AJ20130 - AJ20131 using pAAV hSynapsin FlpO (Addgene #60663), a gift from Massimo Scanzianis (Xue ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Plant Biology 2023Quote: A pair of oligos containing the gRNA sequence were used in conjunction with vector-specific primers (Table S1) for PCR amplification of Medicago truncatula U6 promoter and scaffold from the pUC-gRNA plasmid (Addgene #47024) using Q5® High-Fidelity 2X Master Mix (New England Biolabs) ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Molecular Biology 2020Quote: dCas9 repressor was PCR-amplified with primers containing SfiI sites from dCas9-KRAB-MeCP2 (a gift from Alejandro Chavez & George Church; Addgene plasmid #110821) (Yeo et al. ...
-
bioRxiv - Cancer Biology 2022Quote: The human CRISPR activation pooled library Set A (Addgene plasmid #92379 was a gift from David Root and John Doench ...
-
bioRxiv - Neuroscience 2022Quote: Human CRISPRi sgRNA library Dolcetto Set A17 (Addgene #92385) was transformed into electrocompetent Lucigen Endura™ E ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers 1033F-1038F were individually mixed with primer 1039R and pLdCH plasmid DNA (Addgene #84291, (7)) to amplify an sgRNA expression cassette ...