Labshake search
Citations for Addgene :
1 - 50 of 478 citations for Yellow Fever virus lysate 17D strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Pseudotyped rabies virus (SAD B19 strain, EnvA-RbV-GFP, Addgene# 52487) was commercially obtained from the Janelia Viral Tools Facility stored at −80°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... eiF4E6(GGGGATCCGCCGAACAAGGG) or Yellow (Addgene #49331) guide sequences were inserted ...
-
bioRxiv - Neuroscience 2023Quote: ... and pZac2.1 gfaABC1D-lck-GCaMP6f virus (Addgene virus #52924).
-
bioRxiv - Neuroscience 2020Quote: ... The virus (Addgene plasmid pAAV-hSyn-Flpo ...
-
bioRxiv - Bioengineering 2020Quote: Yellow fluorescence protein (pLEX_970_puro_DEST_YFP gifted by William Hahn (Addgene plasmid # 45295)) and mCherry (plv_mCherry gifted by Pantelis Tsoulfas ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV-CamKII-Cre virus (Addgene) was diluted 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was obtained from Addgene. During surgery ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus pAAV.CAG.GCaMP6s.WPRE.SV40 (Plasmid #100844, Addgene) was injected into the plantar area of the hindpaw using a 10 μl Hamilton syringe with a cannula connected to a 30G needle ...
-
bioRxiv - Synthetic Biology 2021Quote: Strain S2060 (Addgene #105064), a K12 derivative optimized for directed evolution31 was used in all luciferase ...
-
bioRxiv - Neuroscience 2022Quote: ... The GCaMP6 virus (AAV1.Syn.Flex.GCaMP6s.WPRE.SV40, Addgene; titre ...
-
bioRxiv - Neuroscience 2022Quote: ... The virus was produced by Addgene or the Virus Facility of the University Medical Center Eppendorf ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated virus AAV5.CamKII.GCaMP6f.WPRE.SV40 (Addgene # 100834 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-packaged constructs (Addgene, virus # 107790) expressed GCaMP6s under the CaMKIIα promoter to achieve pyramidal cell-predominant expression (Wood et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1.CaMKIIa.hChR2(H134R)-eYFP.WPRE.hGH virus (Addgene) was infused bilaterally in the infralimbic cortex (IL ...
-
bioRxiv - Neuroscience 2023Quote: Adeno-associated virus AAV5.CamKII.GCaMP6f.WPRE.SV40 (Addgene # 100834 ...
-
bioRxiv - Neuroscience 2024Quote: ... virus and pAAV.CAG.LSL.tdTomato (Addgene, stock #100048) virus ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received injections of either hM4Di virus or a control virus (pAAV-S5E2-GFP; Addgene #135631-AAV1). The hM4Di virus was derived from Addgene plasmid 83896 ...
-
bioRxiv - Neuroscience 2019Quote: AAV1-Cre virus was obtained from Addgene (pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2020Quote: ... GCaMP6s virus (pAAV.Syn.DIO.GCaMP6s.WPRE.SV40) was obtained from Addgene, Rabies-EGFP virus (EnvA G-deleted Rabies-EGFP ...
-
bioRxiv - Neuroscience 2022Quote: ... the AAV9.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, MA, USA) was added to the cultures at a final concentration of 1 μl/mL for GCaMP6f expression ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-DIO-GCaMP7s virus from Addgene #104491-AAV1 110 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-GfaABC1D-GCaMP6f virus (Addgene #52925) was stereotaxically injected into the cortex 2 weeks before imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... The hM4Di virus was derived from Addgene plasmid 83896 ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV9 CaMKII-eGFP (3.45×10^12 virus molecules/mL)(Penn) or AAV5-hDlx-ChR2-mCherry (7.6 ×10^14 virus molecules/mL) (Addgene plasmid # 83898 ...
-
bioRxiv - Neuroscience 2024Quote: Time-pregnant wild-type C57BL/6J female mice underwent in utero virus injection of CamkII-cre virus (105558-AAV1, Addgene) into the left side of the lateral ventricles ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV8-CaMKIIa-hM4D(Gi)-mCherry virus (hM4D) (Addgene) or a control virus under the same promoter ...
-
bioRxiv - Neuroscience 2020Quote: The virus (pAAV.Syn.GCaMP6f.WPRE.SV40, Addgene viral prep # 100837-AAV1) (Chen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 250 nl pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, 100833-AAV1, RRID:Addgene_100833) was injected into mitral cell layer at both 200 µm and 300 µm depths (Chen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 250 nl pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, 100833-AAV1, RRID:Addgene_100833) was injected into mitral cell layer at both 200 µm and 300 µm depths (Chen et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... an AAV-CaMKII-cre virus (Addgene/Penn Vector) was injected into cortex (viral titer ...
-
bioRxiv - Neuroscience 2021Quote: The virus (pAAV.Syn.GCaMP6f.WPRE.SV40, Addgene viral prep # 100837-AAV1)42 was delivered using a Picospritzer III (Parker ...
-
bioRxiv - Neuroscience 2021Quote: ... an AAV-CaMKII-cre virus (Addgene/Penn Vector) was injected into barrel cortex (1:10k-1:50k dilution ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-S5E2-dTom-nlsdTom virus (Addgene number: 135630) was packaged by the Janelia Vector core with AAV2/9 serotype (virus titer after 1:1 dilution ...
-
bioRxiv - Neuroscience 2019Quote: ... an AAV-CaMKIIa-eGFP virus (Addgene; 50469-AAV5) was injected into the adult hippocampus of CTRL and CKO mice.
-
bioRxiv - Cancer Biology 2021Quote: ... The virus package plasmids psPAX2 (Addgene plasmid 12260) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Neuroscience 2022Quote: ... infected with Syn- iGluSnFR virus (Addgene #98929-AAV1) at DIV11-14 ...
-
bioRxiv - Physiology 2022Quote: ... AAV8-TBG-Null virus (Addgene, AV-8-PV0148) was used as a control.
-
bioRxiv - Neuroscience 2023Quote: ... virus titer 2.7 x 1013 (AddGene Plasmid #105540). The skull was sealed with bone wax (Med Vet International ...
-
bioRxiv - Neuroscience 2023Quote: ... virus or AAV2- FLEX-sun1GFP (Addgene plasmid# 160141) control virus were packaged by SignaGen at high-titer (1 × 103 gc/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... a retrograde virus (AAV-Retrograde-Cre, Addgene #55636) and a cre-dependent virus (AAV9-DIO-Ef1a-eYFP ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV2retro-CamKIIa-jGCaMP8s-WRPE virus (Addgene #176752) was used for long-term imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV10-CamKII-GCaMP6f-WPRE virus (Addgene #100834) was used to obtain parameters utilized in video simulations and to calculate inter-session missalignment (Extended Data Fig ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV5.Syn.Flex.GCaMP6f.WPRE.SV40 virus was obtained from Addgene.
-
bioRxiv - Neuroscience 2023Quote: ... this same virus (AAV8-CaMKIIa-hM4Di-mCherry, Addgene) was bilaterally infused into two sites in vlOFC (0.2 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... or control AAV2-hSyn-mCherry virus (RRID: Addgene_114472) was injected into the LHb ...
-
bioRxiv - Cell Biology 2023Quote: ... coli strains producing plasmids pEF.CMV.RFP (Addgene #17619 ...
-
bioRxiv - Systems Biology 2024Quote: ... coli plasmid-propagating strains from Addgene, and are a generous gift from the Roth laboratory by way of Addgene [69] ...