Labshake search
Citations for Addgene :
1 - 44 of 44 citations for Urotensin II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... pBluescript II KS(+) (Addgene) was utilized ...
-
bioRxiv - Microbiology 2021Quote: ... the pBluescript II KS(+) (Addgene) was utilized ...
-
bioRxiv - Neuroscience 2020Quote: ... and of (ii) GluA2 (Addgene #24001) by replacing the corresponding pHluorin cDNA within these Addgene clones ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG-Pol-II WT and FLAG-Pol-II-Δ (entire CTD deleted) were gifts from Benjamin Blencowe (Addgene plasmids # 35175 and # 35176 respectively) ...
-
bioRxiv - Developmental Biology 2021Quote: ... or pIRES-hrGFP II-mTET1 (Addgene #83569), and cloned into the NotI digested PCDH-CAG-MCS-P2A-Puro vector (a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... HPAF-II cells stably expressing FUCas9Cherry (Addgene#70182) were transduced with MSMO1 sg RNA or FAXDC2 sgRNA along with pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
bioRxiv - Cancer Biology 2023Quote: ... (ii) HEK293T with 1.3 μg of psPAX2 (Addgene, #12260), 0.8 μg of pVSVG (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... into the XhoI site of pBluescript II SK+ (Addgene, Watertown, MA) to create the plasmid pEcoRI_ASalxh.pBSKS.rev ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Immunology 2019Quote: ... The OT1 sequence was cloned from murine TCR OT1-2A.pMIG II (Addgene). The OT1-iR9-iPSC positive clones were further selected by Puromycin (1 μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: Nos regulator elements drive the myosin II RLC (Eric Wieschaus56, Addgene 20163) fused to tdTomato (Michael Davidson ...
-
bioRxiv - Bioengineering 2020Quote: ... or pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) containing the CRMpMHCIIα constructs ...
-
bioRxiv - Plant Biology 2023Quote: ... A neomycin phosphotransferase II (NPTII) cassette (pICH47732::NOSp::NPTII, Addgene no. 51144) was used as selectable marker for plant transformation ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Neuroscience 2024Quote: ... and ii) PCR fragment of FLPo originated from pTCAV-FLEx-FLPo (#67829, Addgene). Because a nuclear localization signal (NLS ...
-
Contractile acto-myosin network on nuclear envelope remnants positions human chromosomes for mitosisbioRxiv - Cell Biology 2019Quote: ... & MHC-GFP (pT3153, CMV-GFP-NMHC II-A, a gift from Robert Adelstein, AddGene #11347). For transfection of plasmids ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Cancer Biology 2022Quote: ... HS-SY-II and SYO1 synovial sarcoma cell lines were transduced with lentiCas9-Blast85 (Addgene, #52962) and selected using 20 μg/ml of blasticidin to generate stable Cas9-expressing cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Microbiology 2022Quote: ... This fragment was then inserted into the pLenti-mCherry-Mango II x 24 plasmid (Addgene #127587) digested with Nhe I and BamH I ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Cell Biology 2020Quote: ... Fragments were purified by agarose gel electrophoresis and individually subcloned into BamHI/NotI-digested pBluescript II KS+ (Addgene). Colonies positive for the plasmid were selected on LB agar with 100 μg/ml ampicillin (Gibco from Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+) (Addgene, 212205) by restriction-enzyme based cloning and the cHS4-CAG-nlstdTomato-cHS4 and cHS4-CAG-nlsGFP-cHS4constructs ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Genetics 2020Quote: ... Gibson assembly was used to clone the Vasa-β-globin-II fragment from the Vasa-Cre plasmid (Addgene; 15885) (Gallardo et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gene encoding Cas3/I-G was cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). All the clones were confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2020Quote: βII-spectrin-ΔCH-GFP and βII-spectrin-ΔPH-GFP plasmids were modified from FUGW-GFP plasmid (Addgene, 14883, Cambridge, MA). In details ...
-
bioRxiv - Cell Biology 2020Quote: ... we amplified two DNA fragments with PCR and used Gibson assembly to subclone these into the BamHI site of pBluescript II KS+ (Addgene). The first fragment ...
-
bioRxiv - Molecular Biology 2022Quote: ... R179A and R320A were PCR amplified and cloned into pET Strep II co-transformation cloning vector (13S-R, Addgene # 48328). Csb3/I-G was cloned into pQE2 (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sense and antisense riboprobes were designed by subcloning fragments of coding cDNA sequences in pBlueScript II (SK or KS) plasmids (Addgene). Riboprobes were generated by in vitro transcription using the SP6/T7 DIG RNA labelling kit (Roche ...
-
bioRxiv - Immunology 2023Quote: ... Myc overexpression was achieved using the Nucleofector™ II/2b (Amaxa, Koelin, Germany) with pMXs-cMyc plasmid (Addgene plasmids #13375). Naive CD4+ T cells were resuspended in 100μl nucleofector solution (Amaxa ...
-
The haplolethal gene wupA of Drosophila exhibits potential as a target for an X-poisoning gene drivebioRxiv - Genetics 2024Quote: ... attP40{nos-Cas9}/CyO which carries a recessive lethal allele on the second chromosome and cannot be made homozygous) or (ii) a line we generated that has nos-Cas9 (from Addgene plasmid 62208 courtesy of Simon Bullock which has a single NLS and a 3’UTR from nanos ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then LR clonase II reactions were used to shuttle ORFs into pCW-DEST (lentiviral Dox-inducible expression) derived from pCW-Cas9 (Addgene # 50661), and pmax-DEST (transient constitutive expression ...
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Molecular Biology 2022Quote: ... and ΔC (251-545 aa) truncation domains were PCR amplified and cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). The genes encoding Csb1/I-G ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Biophysics 2021Quote: Clones of MDCKII expressing GFP-myosin-2-A were created by transfecting cells with pTRA-GFP-NMCH II-A plasmid (Addgene plasmid # 10844). Stable expressing clones were selected via Neomycin resistance (G418) ...
-
bioRxiv - Microbiology 2021Quote: ... vCyclin and vGPCR were amplified by PCR using the cDNA prepared from iSLK.219 as templates and cloned into the Bgl II and EcoR I restriction sites of the pMSCV-puro lentiviral vector (Addgene plasmid # 68469). vFLIP were cloned by inserting its PCR fragment into the modified pMSCV-puro-3HA vector at Bgl II and Xho I restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... A pLVX-GFP-MYH9 transfer plasmid was cloned by ligating a NdeI/SalI-digested GFP-MYH9 cassette from CMV-GFP-NMHC II-A (gift from Robert Adelstein, Addgene plasmid #11347) into NdeI/XhoI-digested pLVX-Puro vector ...
-
bioRxiv - Immunology 2024Quote: ... The murine CD3 WTdelta-F2A-gamma-T2A-epsilon-P2A-zeta pMIA II plasmid was a gift from Dario Vignali (Addgene plasmid # 52093) [40] ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Mice were unilaterally injected using a Nanoject II programmable nanoliter injector with 600 nL/hemisphere with AAV5-hSyn-dLight1.2 (Addgene Cat. #111068-AAV5) [33] into the NAc core using stereotaxic bregma-based coordinates ...
-
bioRxiv - Genetics 2024Quote: ... We next used the Gateway™ LR Clonase™ II Enzyme mix to recombine each of the four PCR products into the pBID-UASC-G backbone (Addgene Plasmid #35202), which contains a φC31 integrase compatible attB sequence and UAS binding sites for the GAL4 expression system (Wang et al ...