Labshake search
Citations for Addgene :
1 - 29 of 29 citations for Tyr PDGF A Chain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... a wild copy of the TYR gene was PCR amplified form the pEGFP-TYR plasmid (Addgene, 32781) with NheI and AgeI overhangs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2xU6:p53/tyr gRNA mitfa:Cas9 (Addgene #118844) are published (tyr gRNA= GGACTGGAGGACTTCTGGGG ...
-
bioRxiv - Immunology 2023Quote: ... Amplicon from the first PCR reaction were used as templates for cloning into antibody expression vectors (Abvec2.0-IGHG1 for the heavy chain and Abvec1.1-IGKC or Abvec1.1.-IGLC2-XhoI for of the light chains, all from AddGene).
-
bioRxiv - Bioengineering 2024Quote: ... pcDNA3.1-Tras heavy chain-SpyTag003 (‘Tras NoLink’) and pcDNA3.1-Tras light chain (GenBank and Addgene deposition in progress) were cloned previously by Jamie Lam (University of Oxford ...
-
bioRxiv - Neuroscience 2023Quote: ... Polycistronic CRISPR plasmids pX33075 and pX45876 were optimized so that one vector contained two U6 promotors with two sgRNA sequences.39 Guide RNA sequences were chosen as described.77,78 The DNA sequence encoding the TagRFP-T_A1aY1 Tyr-T sensor was amplified from Addgene plasmid #158751 (a gift from Minhajuddin Sirajuddin43 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PDGF-TMD-GFP plasmid (pFU-no toxin-PE) was a gift from Ines Ibanez-Tallon (Addgene plasmid # 24149) 29.
-
bioRxiv - Cancer Biology 2021Quote: ... and single-chain gRNA encoding plasmid (MLM3636, AddGene #43860) were gifts from Keith Joung ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with mCherry – clathrin light chain B (Addgene Plasmid #55019) and EGFP – clathrin light chain A52 plasmids ...
-
bioRxiv - Physiology 2021Quote: ... The alpha myosin heavy chain/puro rex/neo was a gift from Mark Mercola (Addgene plasmid #21230 ...
-
bioRxiv - Molecular Biology 2021Quote: Notch1 and Jagged1 constructs were generated by polymerase chain reaction (PCR) using mouse Notch1 (Addgene 41728), human Notch1 (kind gift of Dr ...
-
bioRxiv - Cell Biology 2023Quote: Keratin sequences were cloned by polymerase chain reaction (PCR) from pBabe-RFP1-KRT5-hygro (Addgene #58493) and pDONR22-KRT6A (DNASU clone HsCD00039474 ...
-
bioRxiv - Neuroscience 2021Quote: ... we co-transfected neurofilament medium chain (NFM) cDNA-containing plasmid pmNFM (a gift from Anthony Brown, Addgene plasmid #83126 ...
-
bioRxiv - Neuroscience 2021Quote: Tetanus toxin light chain (TeTxLC) was amplified by PCR from pGEMTEZ-TeTxLC (Addgene #32640, (Yu et al., 2004)) using forward primer ...
-
bioRxiv - Neuroscience 2021Quote: ... hM3Dq-mCherry cDNA was polymerase chain reaction (PCR)-amplified from pAAV-hSyn-hM3D(Gq)-mCherry (Addgene plasmid #50474) and transferred to the lentiviral vector CSIV with the CAG promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... was amplified by polymerase chain reaction from pGP-CMV-GCaMP6s plasmid (a gift from Douglas Kim, Addgene plasmid # 40753) and inserted into the multi-cloning site of Adeno Associated Virus (AAV ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127 ...
-
bioRxiv - Biophysics 2023Quote: ... The cDNA clones were amplified by polymerase chain reaction and subcloned into pLV-EF1a-IRES plasmid-blast vector (Addgene #85133), which we further engineered to introduce the HaloTag sequence for N-terminal tagging ...
-
bioRxiv - Biochemistry 2019Quote: ... The MIT-linker-BECN1 construct was then generated by amplifying residues 1-159 of NRBF2 including S113A and S120A with an overlapping linker sequence and performing two-step polymerase chain reaction with BECN1 and moved into vector 6A obtained from UC Berkeley macrolab (Addgene # 30124). Cells were lysed by gentle shaking in lysis buffer (50 mM HEPES ...
-
bioRxiv - Microbiology 2022Quote: ... with a 15 base pair overlap with vector backbone were used in a polymerase chain reaction (PCR) to generate fast Timer protein timer fragment from plasmid pFast-FT-N1 (Addgene 31910). Five tandem repeats of Tax responsive element (TRE ...
-
bioRxiv - Biochemistry 2020Quote: ... The coding region of the SunTag and Kif18b was obtained by polymerase chain reaction (PCR) of a pCMV-SunTag-Kif18b-PP7 template (Addgene #128606), using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting chimera genes for the light chain and the His-tagged heavy chain of the Fabs were separately cloned into the pCAGEN vector (a gift from Connie Cepko (Addgene plasmid #11160)) 34 ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Neuroscience 2022Quote: ... Yap1 and Yap1-5SA with attB sites were amplified PCR (polymerase chain reaction) from pQCXIH-Myc-Yap1(5SA) (a kind gift from Kunliang Guan, Addgene plasmid # 33093) and pcDNA3-Yap1 (a kind gift from Stefano Piccolo ...
-
bioRxiv - Immunology 2020Quote: ... TCRα or TCRβ chains were amplificated from the corresponding nested PCR mixtures and cloned into the lentivirus vector pWPXL (Addgene Plasmid #12257). The constant regions were replaced by mouse counterparts with improved TCR pairing and TCR/CD3 stability that were convenient for the detection of TCR-T cells (Cohen et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetanus Neurotoxin Light Chain (TeLC) viruses were generated using AAV5-hSyn-FLEX-TeLC-P2A-dTomato (Addgene, 159102, 1 × 1013 genome copies per ml) at ISTA viral facility ...
-
bioRxiv - Immunology 2023Quote: ... Variable regions were cloned into pVITRO1 plasmids that already contained the constant regions for human IgG1 heavy and light chains (κ or λ, Addgene plasmids #61883 and #50366)85 using Gibson Assembly75 ...