Labshake search
Citations for Addgene :
1 - 50 of 54 citations for TRAP 14 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Single and double RNAi constructs targeting endogenous trap-1 and trap-3 were cloned by inserting the spliced coding sequences of trap-1 and trap-3 into vector L4440 (Addgene plasmid #1654). The constructs were then transformed into the RNAi feeding E ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... TadA8e (Addgene #138489)14 and Tad8.20m (Addgene #136300)50 were PCR amplified and inserted into empty entry vectors by Gibson assembly.
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid #54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid #54560 ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia1-N-14 (Addgene plasmid#54157), mEmerald-mDia2-N-14 (Addgene plasmid #54159) ...
-
bioRxiv - Microbiology 2021Quote: ... mEmerald-mDia2-N-14 (Addgene plasmid #54159), and mRuby-LifeAct-7 (Addgene plasmid#54560 ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald-MyosinIIA-N-14 (Addgene plasmid #54191) and mApple-LC-myosin-C-10 (Addgene plasmid #54919 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... mEmerald-ARP2-C-14 (gift from Michael Davidson, Addgene plasmid # 53992); MICAL-L1 (Origene ...
-
bioRxiv - Genetics 2022Quote: ... and SETMAR (aa 14-277) was amplified from SETMAR (3BO5) (Addgene plasmid # 25250 ...
-
bioRxiv - Synthetic Biology 2022Quote: LifeAct-14-EGFP plasmid was received as agar stabs (#158750, Addgene) (Kumari et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132; http://n2t.net/addgene:54132; RRID:Addgene_54132) and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Cancer Biology 2022Quote: ... p3XFlag-CMV-14-WDR5 was a gift from Debu Chakravarti (Addgene #59974). A list of cloning oligos is available in Table S4.
-
bioRxiv - Cell Biology 2022Quote: mEmerald-Zyxin-C-14 construct (Addgene # 54318; a gift from Michael Davidson) was cloned into the lentiviral vector pLL5.0 (Vitriol et al. ...
-
bioRxiv - Neuroscience 2021Quote: Primary hippocampal neurons were transiently transfected on DIV 14 with α2δ2 (Addgene) or pcDNA plus RFP plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
Inhibition of nucleotide synthesis promotes replicative senescence of human mammary epithelial cellsbioRxiv - Systems Biology 2019Quote: Proliferating HMEC were infected at PD 14 with pLenti-PGK-hygro (Addgene 19066) encoding either hTERT or firefly luciferase ...
-
bioRxiv - Systems Biology 2021Quote: ... proliferating HMECs were infected at PD 14 with pLenti-PGK-hygro (Addgene 19066) encoding either hTERT or firefly luciferase ...
-
bioRxiv - Developmental Biology 2021Quote: ... from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Developmental Biology 2023Quote: ... Plasmid with mCherry-2A-rTetR-CBX7 was created by subcloning mCherry-2A-rTetR (Addgene # 78101)14 and CBX7 into lentiviral expression vector backbone pLVU-tTR-KRAB (Addgene# 11645)71 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ was subcloned into pmTurquoise2-N1 (Addgene, Massachusetts, USA; plasmid # 54843) using restriction enzymes EcoRI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... The ace2 gene was amplified from a plasmid gifted by Hyeryun Choe 14 (Addgene plasmid # 1786 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reporter constructs contained 14 UAS sites for Gal4-DBD binding (source: Addgene 128010), an enhancer and a core promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were transfected with pFlagCMV2-14-3-3sigma (Addgene, Cambridge, MA, Plasmid #12453) (68) ...
-
bioRxiv - Immunology 2023Quote: ... and HLA-C0702 encoding cDNA (IDT) were inserted into pSBbi-GP[14] (Addgene plasmid # 60511) using the NEBbuilder HiFi Assembly Master Mix ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309 ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV5 CaMKII-hM3Dq-IRES-mCitrine (3.75×10^14 or 3.75×10^13 virus molecules/mL) (Addgene plasmid #50466 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... al.14 The pCS2-mNG-C (the CMV mNG plasmid) was purchased from Addgene (plasmid #128144).
-
bioRxiv - Biochemistry 2021Quote: ... coli BL21(DE3) RIL from the pET-derived vector 14-B (a gift from S. Gradia; Addgene 48308) in LB medium individually ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309; http://n2t.net/addgene:48309; RRID:Addgene_48309) via ligation-independent cloning (primer sequences ...
-
bioRxiv - Microbiology 2020Quote: ... The ace2 gene was amplified from a plasmid gifted by Hyeryun Choe 14 (Addgene plasmid # 1786; http://n2t.net/addgene:1786; RRID:Addgene_1786) using CoV-39 and CoV-40 primers ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: The reporter construct (traffic jam enhancer driven GFP_P2A-Blasticidin-resistance harboring 10 intronic boxB sites and 14 upstream UAS sites; plasmid submitted to Addgene) was integrated into chromosomal location chr2L:9,094,918 ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV9 CaMKII-eGFP (3.45×10^12 virus molecules/mL)(Penn) or AAV5-hDlx-ChR2-mCherry (7.6 ×10^14 virus molecules/mL) (Addgene plasmid # 83898 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Biochemistry 2023Quote: The 6xHis-SUMO-14-3-3ζ construct used in this work (kind gift of prof. B.M. Burmann) was derived from GST-14-3-3ζ (Addgene #13278)26 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5X106 purified T cells were electroporated (program U-14) in presence of the pT4.iC9.79D vector and the transposase SB100X plasmid (Addgene 34879) or of the transposase SB100X mRNA ...
-
bioRxiv - Microbiology 2021Quote: ... The ZIKV sfRNA sequence and GFP gene fragment were PCR amplified from pUC19-ZIKV-F4 14 and pMYC-GFP (Addgene, #42142) plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7 ...
-
bioRxiv - Microbiology 2022Quote: GFP and myc-tagged 14-3-3ε were generated as follows: a G-block containing the full-length 14-3-3ε protein (IDT) was cloned into pEGFP-C1 (Addgene #2487) using XhoI and BamHI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... The pAAV-hSyn-DIO-mCherry (titer 4.56 e+14 gc/ml) was produced in an in-house viral production facility using the plasmid ordered from Addgene (#50459). The pAAV2/9-pCAG-FLEX-alpha-synuclein(A53T)-3*Myc-WPRE (mutated pαSyn ...
-
bioRxiv - Microbiology 2023Quote: HPV16 PsVs were produced by co-transfecting 293TT cells with wild-type p16SheLL-3XFLAG tag [14] together with pCAG-HcRed (Addgene #11152) or pCINeo-GFP [obtained from C ...