Labshake search
Citations for Addgene :
1 - 50 of 218 citations for TNF Receptor Superfamily Member 6 CD95 TNFRSF6 FAS Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... AAV1.CBA.DO(FAS).GCaMP6s (Addgene plasmid 110135 from Bernardo Sabatini (40) ...
-
bioRxiv - Cancer Biology 2023Quote: Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
bioRxiv - Physiology 2019Quote: ... FAS promoter luciferase was a gift from Bruce Spiegelman (Addgene plasmid # 8890). pcDNA4 myc PGC-1 alpha was a gift from Toren Finkel (Addgene plasmid # 10974) ...
-
bioRxiv - Neuroscience 2021Quote: ... were infused bilaterally with AAV expressing the inhibitory designer receptor human M4 muscarinic receptor (hM4Di; AAV8-hSyn-hM4Di-mCherry, 4.8 × 1012 or 3.7 × 1012 vg/mL; Addgene; 0.3 μL) at a rate of 0.1 μL/min into the mOFC (AP ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible inhibitory designer receptor human M4 muscarinic receptor (hM4DGi; AAV2-Syn-DIO-hM4Di-mCherry; Addgene) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Immunology 2020Quote: ... Codon optimized Leucine Zipper CD95 (LZ-CD95L) gene was synthesized by IDT with EcoRI and BamHI sites and cloned into pcDNA3.1(-) (Addgene #104349).
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible excitatory designer receptor human M3 muscarinic receptor (hM3Dq; AAV2-Syn-DIO-hM3Dq-mCherry; Addgene, Watertown, MA) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Physiology 2022Quote: ... HA-cholinergic M3 receptor cDNA was from Addgene (# 40753). BPTU (1-(2-(2-(tert-butyl)phenoxy)pyridin-3-yl)-3-(4-(trifluoromethoxy ...
-
bioRxiv - Neuroscience 2023Quote: ... FLAG-CDKL5 and dopamine D2 receptor (gfp-DRD2, Addgene) were co-transfected at a ratio of 2:0.75:1.
-
bioRxiv - Synthetic Biology 2024Quote: ... TNF (pLI_TNF, which was a gift from Veit Hornung, Addgene plasmid #171179)29 ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Bioengineering 2022Quote: ... a stimulatory G-protein coupled receptor (custom made Chemogenetics AAV: Addgene). Clozapine-N-oxide (CNO ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794 ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Cell Biology 2021Quote: ... Histamine receptor construct pH1R-P2A-mCherry-N1 was purchased from Addgene (product: 84330). For a plasma membrane marker for use in total cell fluorescence calculations ...
-
bioRxiv - Physiology 2019Quote: HepG2 cells were transfected with the luciferase expression construct under the Fatty Acid Synthetase (FAS) Promoter (Addgene# 8890) along with β-Gal plasmid (Ambion Cat ...
-
bioRxiv - Neuroscience 2020Quote: ... GABA (A) receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168 ...
-
bioRxiv - Bioengineering 2020Quote: synNotch receptors and response elements were obtained from Addgene (Addgene plasmids #79123 and 79125). The ScFv library with the N-terminal CD8α signal peptide was fused to the synNotch-Gal4VP64 receptor backbone (Addgene plasmid #79125 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Neuroscience 2022Quote: ... Addgene) designer receptors exclusively activated by designer drugs (DREADD) or control (pAAV8-hSyn-EGFP; Addgene) were delivered into the dLS as described for GCaMP7 (see 2.4.1 ...
-
bioRxiv - Microbiology 2023Quote: ... Human codon-optimized full-length Eph receptors were subcloned from pDONR223-EphB1 (Addgene # 23930 (82)) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A plasmid containing estrogen receptor alpha (pEGFP-C1-ERα) was obtained from Michael Mancini (Addgene #28230) and mutated into a constitutively active form (pEGFP-C1-ERαY537S)29 using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Biophysics 2022Quote: ... and pET21a-BirA (Biotin Ligase) was a gift from Alice Ting (Addgene plasmid # 20857 ...
-
bioRxiv - Microbiology 2021Quote: ... 2017 #6} (Addgene, Cat#1000000115), and verified by PCR ...
-
bioRxiv - Physiology 2023Quote: ... 6 μg of psPAX2 (Addgene), and 15 μg of pLV6-BMAL1-Luc vector (Addgene) ...
-
bioRxiv - Microbiology 2019Quote: ... ADRB1 was amplified from pcDNA3 Flag beta-1-adrenergic-receptor (gift from Robert Lefkowitz; Addgene plasmid # 14698). All fragments contained ~20bp overhangs and were assembled into EcoRV cut pLenti CMV Puro DEST (w118-1 ...
-
bioRxiv - Immunology 2024Quote: HEK293T cells were transfected with 3 µg of pmirGLO plasmid containing the 3’UTR of Zc3h12a or Tnf (Addgene plasmid 207127) (7 ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794; http://n2t.net/addgene:55794; RRID:Addgene_55794) 39 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This receptor harbors a myc-tag on its extracellular domain that can be visualized by immunostaining (Addgene #79128). A second virion expresses both the mCherry reporter and BFP under control of the Tetracycline responsive element (TRE-3G ...
-
bioRxiv - Synthetic Biology 2023Quote: A lentiviral transfer plasmid encoding encoding an anti-CD19 synNotch receptor driven by pPGK was acquired from Addgene (pHR_PGK_antiCD19_synNotch_Gal4VP64 was a gift from Wendell Lim ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049; http://n2t.net/addgene:24049; RRID:Addgene_24049). This construct (hIR ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996; http://n2t.net/addgene:14996; RRID:Addgene_14996). For ITGAV depletion ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Developmental Biology 2021Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 μg of psPAX2 (12260; Addgene), and 3 μg of pVSVg (8454 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 µg PMD2.G (Addgene, 12259), 18µg PsPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: Constitutively active androgen receptor (EGFP-C1-AR-V7)26 was obtained from Michael Mancini and Marco Marcelli (Addgene #86856). A plasmid containing estrogen receptor alpha (pEGFP-C1-ERα ...