Labshake search
Citations for Addgene :
1 - 50 of 382 citations for TET 830 modified since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... we modified pMK243 (Tet-OsTIR1-PURO) from Masato Kanemaki (Addgene #72835). pMK243 was digested by BgIII and MluI to remove OsTIR sequence ...
-
bioRxiv - Microbiology 2023Quote: ... in the target plasmid pMB2a-tet (a modified version of Addgene number ...
-
bioRxiv - Neuroscience 2021Quote: ... TeT-O-FUW-Brn2 (Addgene plasmid # 27151 ...
-
bioRxiv - Neuroscience 2021Quote: ... TeT-O-FUW-Ascl1 (Addgene plasmid # 27150 ...
-
bioRxiv - Neuroscience 2023Quote: ... Tet-O-FUW-EGFP (Addgene plasmid #30130 ...
-
bioRxiv - Neuroscience 2024Quote: ... were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150 ...
-
bioRxiv - Neuroscience 2021Quote: ... and TeT-O-FUW-Myt1L (Addgene plasmid # 27152 ...
-
bioRxiv - Cell Biology 2019Quote: ... tet-inducible OsTIR1 (pMK243; Addgene #72835). Cells were selected with 0.5 mg/mL Geneticin (Thermo-Fisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... Tet-O-FUW-eGFP (Addgene #30130): 0.05μL per 5×104 cells ...
-
bioRxiv - Cell Biology 2024Quote: ... EZ-Tet-pLKO-Puro (Addgene #85966) was a gift from Cindy Miranti and both psPaX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: Tet-pLKO-puro (Addgene plasmid #21915) constructs for doxycycline-induced shRNA expression were generated according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs with sequences listed in Table S3 were cloned into tet-inducible vector Tet-pLKO-puro (Addgene #21915). To generate luciferase reporters ...
-
bioRxiv - Neuroscience 2023Quote: ... Tet-O-NFIB-hygro (Addgene plasmid #117271), and FUdeltaGW-rtTA (Addgene plasmid #19780) ...
-
bioRxiv - Cancer Biology 2019Quote: Tet-pLKO-puro was purchased from Addgene (21915). sh-RNAs were cloned as previously described (https://mcmanuslab.ucsf.edu/protocol/cloning-small-hairpins-lentiviral-vectors ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral vector pLKO-Tet-On (Addgene Plasmid #21916) was used to generate inducible knockdown clones of MSI2 and EIF3A (19 ...
-
bioRxiv - Neuroscience 2022Quote: ... and Tet-O-FUW-EGFP (Addgene plasmid #30130) and pTet-O-Ngn2-puro (Addgene plasmid #52047 ...
-
bioRxiv - Molecular Biology 2023Quote: ... lipofection with Tet-pLKO-puro (Addgene plasmid #21915) shRNA containing lentiviral constructs or a scrambled lentivrial construct (Addgene plasmid #162011 ...
-
bioRxiv - Cell Biology 2023Quote: ... was cloned into pLKO-Tet-On (Addgene #21915).
-
bioRxiv - Molecular Biology 2022Quote: ... EZ-Tet-shCPSF6-Puro was generated by inserting a short hairpin RNA targeting CPSF6 into EZ-Tet-pLKO-Puro (Addgene, 85966) between the NheI and EcoRI sites ...
-
bioRxiv - Cancer Biology 2024Quote: Temporally controlled knockdown of Plexin-B2 was achieved with TET-ON lentiviral vectors expressing doxycycline (Dox)-inducible shRNA targeting PLXNB2 (pLKO-Tet-On-PLXNB2–shRNA2; deposited as Addgene #98400). Puromycin selection at 1 µg/ml was used to establish transduced cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... pMK243 (Tet-OsTIR1-PURO) was purchased from Addgene (#72835) and the OsTIR1 fragment was removed by BglII and MluI digestion ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tet-pLKO-puro (Wiederschain et al., Addgene plasmid #21915), CALCRL MISSION shRNA (shCALCRL#1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pTRIPZ-EZH2 and Tet-pLKO were purchased from Addgene. pTRIPZ-STAT5a-CA and pTRIPZ-FLT3-ITD were created by cloning STAT5A and FLT3-ITD from cDNA from MV4;11 cells ...
-
bioRxiv - Cell Biology 2019Quote: ... pMK243 (Tet-OsTIR1-PURO) was purchased from Addgene (#72835) and the OsTIR1 fragment was removed by BglII and MluI digestion ...
-
bioRxiv - Neuroscience 2023Quote: ... and PB-tet-hNIL (Addgene 172113; lower motor neurons) as recently described 62,63 with no protocol modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... or Tet-On lentiviral RNAi construct RT3REN (Addgene; 111166)65 ...
-
bioRxiv - Neuroscience 2024Quote: ... were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150, pLV.PGK.mLmx1a Addgene plasmid #33013 ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-pLKO-puro was a gift from Dmitri Wiederschain (Addgene plasmid #21915 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-pLKO-puro (gift from D. Wiederschain, Addgene plasmid # 21915) was digested with AgeI and EcoRI and isolated by gel purification (QIAEX II Gel Extraction Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... for constitutive knockdown or Tet-pLKO-puro (Addgene Plasmid #21915) for periodic knockdown which was pre-linearized with AgeI-HF (NEB # R3552L ...
-
bioRxiv - Cancer Biology 2021Quote: The Tet-pLKO-puro all-in-one vector (RRID: Addgene_21915) including a puromycin resistance cassette and a tet-responsive element for expression of shRNAs was established according to a publicly available protocol (46 ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA sequences were constructed into pLKO-TET-ON (Addgene # 21915). Sequences of sgRNA and shRNA are provided in Supplementary Table 4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pLKO.1-Tet-Neo obtained from Addgene. For inducible shRNA constructs ...
-
bioRxiv - Cancer Biology 2021Quote: Tet-pLKO-puro was a gift from Dmitri Wiederschain (Addgene plasmid # 21915 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cloned into the EZ-Tet-pLKO-Puro vector (AddGene) using the InFusion ligation kit (Takara Bio) ...
-
bioRxiv - Cancer Biology 2020Quote: ... hairpins were cloned into Tet-pLKO-puro plasmid (21915; Addgene). Lentiviral supernatants were generated by transfecting the plasmids into 293T cells and used to infect 8988T cells that were then selected for at least 7 days with 2 μg ml−1 puromycin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used pLKO-Tet-On-shRNA-Control plasmid (98398, Addgene). dCasRx-FTOWT-HA plasmid was received as a generous gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... (24)] were subcloned into Tet-pLKO-puro vector (Addgene #21915). The lentiviruses encoding shPTPN11 were packaged in HEK293T cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Tet-pLKO-puro vector was obtained from Addgene (#21915) and cloning of the shDYRK3-2 hairpin (TRCN0000000647 ...
-
bioRxiv - Neuroscience 2024Quote: ... The Tet-O-FUW-EGFP was obtained from Addgene (#30130). Lentiviral production was performed as previously described (Mattiassi et al. ...
-
bioRxiv - Genomics 2024Quote: Empty Tet-pLKO-puro plasmid70 was purchased from Addgene (#21915), and shRNA oligos for insertion (Table 1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLKO tet-on scrambled (sh-Scr) was purchased from Addgene (47541). See Extended Data table 2 for sh-RNA sequences.
-
bioRxiv - Molecular Biology 2020Quote: ... Tet-inducible Luciferase reporter was a gift from Moritoshi Sato (Addgene plasmid # 64127 ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs were subcloned into a Tet-on pLKO-puro (Addgene, #21915) via AgeI and EcoRI restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... annealed and then ligated into pLKO-Tet-on (Addgene plasmid #21915) (Wiederschain et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA oligos were cloned into Tet-pLKO-puro (Addgene plasmid #21915) vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl and shHOXB13 were cloned into Tet-pLKO-puro (Addgene #21915). sgRNA and shRNA sequences can be found in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into the Tet-on plasmid TLCV2 (Addgene plasmid #87360) digested with the same enzymes ...
-
bioRxiv - Molecular Biology 2020Quote: ... were annealed and cloned into AgeI/EcoRI-linearized tet-pLKO-puro (Addgene plasmid #21915 ...