Labshake search
Citations for Addgene :
1 - 50 of 1088 citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid EDEN15 (Addgene plasmid # 107252 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cdc2-HA plasmid was obtained from Addgene (#188818).
-
bioRxiv - Microbiology 2022Quote: The RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253 ...
-
bioRxiv - Biophysics 2022Quote: The amber suppressor tRNA sequence was translated from the plasmid pANAP (Addgene #48696) (Chatterjee and Guo ...
-
bioRxiv - Molecular Biology 2022Quote: sgRNAs targeting selected MYC binding motifs (E-boxes) were designed using transCRISPR and cloned into lentiCRISPR_v2 vector (Addgene #5296126) (Table 2) ...
-
bioRxiv - Biophysics 2022Quote: ... and ANAP-specific amber suppressor tRNA/tRNA synthetase pair (Addgene #48696 (Chatterjee and Guo, 2013)) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid EDEN15 (Addgene plasmid # 107252; http://n2t.net/addgene:107252; RRID:Addgene_107252) were gifted by Paul Khavari ...
-
bioRxiv - Biochemistry 2021Quote: ... or control peptides with the binding motifs mutated were fused to C terminus of EGFP and cloned to pLJM1-EGFP vector (David Sabatini lab, Addgene plasmid #19319).
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253; http://n2t.net/addgene:107253; RRID:Addgene_107253)] ...
-
bioRxiv - Microbiology 2022Quote: The RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253; http://n2t.net/addgene:107253; RRID: Addgene_107253)] and the BASU RaPID plasmid (Addgene plasmid # 107250 ...
-
bioRxiv - Genomics 2021Quote: ... Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). PUF9R-tethered iRFP670 and mRuby2 were created by a combination of PCR (from IDT gBlocks ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Biochemistry 2022Quote: ... cells with an additional plasmid encoding for an arabinose-inducible promoter to express Amber-suppressor tRNA (tRNACUA) and a biorthogonal tRNA synthetase (Addgene #31186)(37) ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FOP flash (mutated TCF binding sites; Addgene#12457) luciferase expression vectors and with Renilla luciferase vector (control ...
-
bioRxiv - Cell Biology 2023Quote: ... or MRE plasmid with mutated TCF binding sites (Addgene, 12457), together with 100 ng of the Renilla luciferase control plasmid (Addgene ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNA binding sequence (AAGAGGTACGTACAGGTACT) was inserted into the vector pDD162 (from Addgene) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Cell Biology 2019Quote: ... the guide RNA sequence (Supplemental Item 2) was cloned into the PX330 plasmid (Addgene #42230), which expresses S ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all TF binding site and mKate sequences were derived from SPECS plasmids (Addgene #127842). The NFAT response element was subcloned from the pSIRV-NFAT-eGFP plasmid68 (a gift from Peter Steinberger ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reporter constructs contained 14 UAS sites for Gal4-DBD binding (source: Addgene 128010), an enhancer and a core promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL1R1 sgRNA was custom designed against IL1R1 promoter G-quadruplex (G4-motif B) and cloned in pX333 (Addgene 64073) backbone after replacing Cas9 with mCherry.
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (wt p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442). The DNA polymerase used was Phusion High Fidelity (cat# E0553S ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Genomics 2019Quote: ... A guide RNA sequence with a suitable protospacer adjacent motif (PAM) was found nearby the excision site (Figure 1A, Table S1) and cloned into gRNA_Cloning Vector (Addgene 41824)17 ...
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The CRISPR line robo1ΔWIRS was generated by cloning a guide targeting the WIRS motif into a pCFD3-dU6:3 backbone (Addgene, #49410) and sending positive clones to BestGene Inc ...
-
bioRxiv - Biochemistry 2021Quote: URA7 and URA8 wild type genes with ribosomal binding site were cloned into pet28b-6His (Addgene, Massachusetts ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Streptomyces pyogenes (sp) guide RNA sequences (Table 2) were cloned into the LentiGuide-Puro plasmid (plasmid #52963, Addgene). lentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Neuroscience 2019Quote: ... Expression of soma-targeted-ChrimsonR was achieved by stereotaxic injection of AAV serotype 1 carrying ChrimsonR-EYFP fused to a Kv2.1 somatic lo alization motif (“fle - ChrimsonR-EYFP-kv”, Addgene plasmid #135319). Injections were made into right visual cortex of mice aged between P26-P53 ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129) was a gift from Xiaolu Yang (Addgene plasmid # 59743)51 ...
-
bioRxiv - Cell Biology 2024Quote: ... Fragment containing the RFP dropout cassette and the fragment containing the RFP cassette along with the mpknot motif were separately amplified from pU6-pegRNA-GG-aceptor (Addgene #132777) and pU6-tmpknot-GG-acceptor (Addgene #174039) ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Cancer Biology 2023Quote: ... EF.deltaBHES1.Ubc.GFP (DBD-HES1 DNA-binding domain mutant of HES1; #24982) were obtained from Addgene (Cambridge, USA). The reporter plasmids containing the firefly luciferase gene under the control of various fragments of the Hes1 promoter (2.5 kb ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 million hPSCs were transfected with either 400ng WRE plasmid with active TCF binding sites (Addgene, 12456) or MRE plasmid with mutated TCF binding sites (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Cell Biology 2024Quote: ... We then synthesized the NMM motif (sJP203) following the sequence from the pONSY-coNMM:mCherry vector (Addgene #111878, (Parra-Acero et al., 2018)) and cloned this DNA fragment into a KpnI digest of pJP115 using Gibson assembly.
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...