Labshake search
Citations for Addgene :
1 - 50 of 745 citations for Solute Carrier Family 41 Member 2 SLC41A2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and VP12 (41) (Addgene plasmid #72247) was provided by Simon Bullock ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The module 5 was taken from the pAJM.847 plasmid in (41) (Addgene #108524 ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-expressing DND-41 cells were transduced with Human GeCKOv2 library (Addgene 1000000048, 1000000049) at MOI~0.3 and selected with 1μg/ml of puromycin for 6 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pLentiPGK-Blast-DEST-ERKKTRmRuby2 (Plasmid # 90231, Addgene; a kind gift from Markus Cover (41), using Lipofectamine 3000 as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Briefly,41 OsTIR1 (F74G) mutant was first introduced into PB-Ostir-neo(Addgene plasmid #161973) plasmid by overlap PCR to generate AID2 system in C2C12 cells with improved degradation efficiency and reduced background degradation ...
-
bioRxiv - Cell Biology 2020Quote: ... GW1-Mito-pHRed (#31474)41 and pcDNA3-FLAG-Rheb (#19996)61 plasmids were purchased from Addgene.
-
bioRxiv - Cell Biology 2022Quote: ... The HA-ubiquitin plasmid for mammalian expression was a gift from Edward Yeh (Addgene plasmid # 18712 41).
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus particles were packaged in 293T cells by co-transfecting carrier plasmids with psPAX (Addgene, plasmid 12260) and psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2019Quote: ... full length VPA0226 was amplified using primers 3’ GATC AGATCT ATGATGAAAAAAACAATCACACTA 5’ and 5’ GATA GAATTC G GAAACGGTACTCGGCTAAGTTGTT 3’ and cloned in frame with GFP into the expression vector sfGFP-N1 (41) (Addgene) between BglII and EcoRI sites for the expression of C terminally tagged VPA0226 ...
-
bioRxiv - Microbiology 2019Quote: ... were chromosomally tagged with YFP using the mini-Tn7 system 41 (Plasmid pUC18T-mini-Tn7T-Gm-eyfp and pTNS1, Addgene plasmid # 65031 ...
-
bioRxiv - Molecular Biology 2023Quote: ... under the control of the Metallothionein A promoter were generated using the previously described pMT FLAG MCS puro plasmid.26 The reporter plasmid expressing eGFP downstream of the U4:39B snRNA gene was previously described.41 An analogous reporter expressing eGFP downstream of U5:34A snRNA (Hy_U5:34A eGFP SV40, Addgene #195064) was generated from Hy_pPepck1 eGFP SV40 ...
-
bioRxiv - Systems Biology 2020Quote: ... expressed sgRNA and pHAGE TRE-dCas9-VP64 plasmid (a gift from Rene Maehr & Scot Wolfe, Addgene plasmid #50916, RRID: Addgene_50916 41) expressed inactive version of Cas9 (dCas9 ...
-
bioRxiv - Systems Biology 2020Quote: ... expressed sgRNA and pHAGE TRE-dCas9-VP64 plasmid (a gift from Rene Maehr & Scot Wolfe, Addgene plasmid #50916, RRID: Addgene_50916 41) expressed inactive version of Cas9 (dCas9 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded at 20% confluence and infected with lentivirus generated from pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang (41)) engineered to deliver Cas9 and a gRNA targeting LMAN1 (CCCCTTACACTATAGTGACG) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... plasmid or a mixture of hACE2 plasmid (kindly provided by Dr. Markus Hoffman, German Primate Center, Goettingen/Germany) [41] and the Fos-Ct Venus fragment (Addgene 22013). After 24 h ...
-
bioRxiv - Molecular Biology 2020Quote: The pooled Human GeCKO v2 CRISPR knockout plasmid library was a gift from Feng Zhang (41) and obtained from Addgene (#1000000048 and #1000000049). It is supplied as two sub-libraries ...
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus was produced in 293T cells by co-transfecting NF-κB reporter (41) with packaging vectors psPAX2 (Addgene #12260, a gift from Didier Trono) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and subcloned in the pBabe-puro GFP-N-term pCDNA-T0-FRT-Streptag (41) and pSBbi-PUR Sleeping Beauty-based expression vectors (Addgene #6023, a gift from E. Kowarz) (42) ...
-
bioRxiv - Cell Biology 2019Quote: sgRNAs targeting several genes and several non-targeting sgRNAs (listed in SI Appendix, Table S1) were cloned into the pLentiCRISPRv2 plasmid (Addgene:52961, a gift from Feng Zhang (41) as previously described (42) ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #2 (TRCN0000284998, Addgene #136585), shJUND #1 (TRCN0000416347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #2 (TRCN0000416920, Addgene #136583).
-
bioRxiv - Genomics 2019Quote: ... pMDG.2 (3.2µg; Addgene #12259), TKOv3 plasmid library (8µg) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid encoding 2×FKBP-GFP-Rab29 was generated by transferring 2×FKBP sequence from Addgene plasmid #20149 into Hind III site of pCMV10 plasmid followed by inserting EGFP-Rab29 sequence into Not I - Xho I site of pCMV10 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-SARS2-Spike (2) and pcDNA3.1-hACE2 (2) were obtained from Addgene (Addgene plasmids #145032; #145033); pCI-SARS2-Spike expressing a codon optimized version of the gene coding for S protein of SARS-CoV-2 was provided by Nicolas Escriou (Institut Pasteur) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Cell Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... into pPD132.102 (pmyo-2, #1662, Addgene) via restriction with BamHI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2) pEVOL-pBpF (Addgene #31190), which encodes a tRNA synthetase/tRNA pair for the in vivo incorporation p-benzoyl-l-phenylalanine (BPA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pCMV-VSVG (Addgene 8454), 2 μg pMDLg/pRRE (Addgene 12251) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or lentiCRISPRv.2-hygro (Addgene 98291). Validation of guide specificity was assessed by Western blot of low-passage cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pMDLg/pRRE (Addgene 12251), 2 μg pRSV-Rev (Addgene 12253) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pRSV-Rev (Addgene 12253), and 2 μg lentiviral plasmid carrying transgene (LeGO iG-CDK4R24C ...
-
bioRxiv - Immunology 2021Quote: ... 2 µg PMD2G plasmids (12259, Addgene), 40 µL of P3000 Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µL of plasmid (#JS825, Addgene) was diluted in 200 µL Xfect transfection reagent (631317 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 μg psPAX2 (#12260, Addgene) packaging plasmid by using polyethylenimine (Xiang et al ...