Labshake search
Citations for Addgene :
1 - 50 of 120 citations for SDS PAGE Single gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Cloning was performed using the single-step digestion-ligation protocol from the Zhang lab (available on the Zhang lab Addgene page). To validate each guide ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used a single px330 plasmid (Addgene #42230) modified to carry two sgRNA cassettes ...
-
bioRxiv - Bioengineering 2021Quote: ... and a splicing donor (SD) (Addgene#112734) were PCR-amplified using primers listed in Supplementary Table 7 and cloned into the px601 plasmid using an NEBuilder HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... pBOB-CAG-iCRE-SD (Addgene, plasmid #12336) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and single-chain gRNA encoding plasmid (MLM3636, AddGene #43860) were gifts from Keith Joung ...
-
bioRxiv - Genomics 2021Quote: Single CRISPR sgRNAs were cloned into plentiCRISPRv2 (Addgene #52961) as previously described20 ...
-
bioRxiv - Immunology 2023Quote: Single guide RNAs were cloned into LentiCRISPRv2 (Addgene, #52961) to knockout specific gene in HEK293T and Jurkat cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Cell Biology 2022Quote: ... Single sgRNA CDSs were cloned in pLentiCRISPRv2 (Addgene plasmid 52961) to perform stable knock-outs in HEK293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... which expresses Cas9 and a synthetic single-guide RNA (Addgene), as follows ...
-
bioRxiv - Biochemistry 2022Quote: ... single guide RNAs were cloned into the px459 vector (Addgene; 48139). Single guide-RNAs were targeted as follows ...
-
bioRxiv - Biophysics 2021Quote: ... using the single plasmid system from Feng Zhang’s lab (Addgene #62988). All known splice variants of NMHC IIB and NMHC IIC were targeted by the respective sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... CRISPRi libraries (single CRISPRi-v2 library, Non-targeting dual library [Addgene #197348] ...
-
bioRxiv - Cell Biology 2020Quote: ... single gRNA constructs were cloned into lenti-sgRNA blast vector (Addgene: 104993) by BsmBI restriction enzyme cloning ...
-
bioRxiv - Neuroscience 2021Quote: ... a single 100 nL injection of AAV2-retro-GFP (Addgene #37825-AAVrg) was administered to agranular RSC in the left hemisphere (AP ...
-
bioRxiv - Neuroscience 2021Quote: ... a single 250 nL stereotactic injection of AAV2-retro-Syn-EBFP-Cre (Addgene #51507-AAVrg ...
-
bioRxiv - Synthetic Biology 2021Quote: A fresh single colony of E.coli EcM1 bearing pORTMAGE3 (Addgene Plasmid ID #72678) taken from LBa,Km was inoculated into 2 mL LBKm and incubated overnight at 30 °C ...
-
bioRxiv - Neuroscience 2022Quote: We injected a single 100 nL of AAV2-retro-GFP (Addgene #37825-AAVrg) in the left agranular RSC (AP ...
-
bioRxiv - Genomics 2020Quote: ... The single-vector TKOv3-lentiCRISPRv2 library was a gift from Jason Moffat (Addgene #90294) (70) ...
-
bioRxiv - Genomics 2022Quote: A549 cells expanded from a single clone harboring a doxycycline-inducible Cas9 (Addgene #114010) were a gift from J.T ...
-
bioRxiv - Biochemistry 2019Quote: ... on a 3kb plasmid containing a single 601 sequence (pGEM3Z-601 from Addgene #26656) were performed as previously described (32 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Single guide RNA sequences were cloned into the PU6::unc119_sgRNA vector (Addgene plasmid #46169) using the overlapping PCR fragment method described in (Friedland et al ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: Single guide RNA oligonucleotides were cloned into the pSpCas9-2A-GFP vector (Addgene #48138). The guide sequences were as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... A single guide (sg) RNA target sequence (GATGTAATTACCACATACGA) was cloned into pDD162 (Addgene Plasmid # 47549) for expression of both sgRNA and Cas9 nuclease ...
-
bioRxiv - Biochemistry 2019Quote: ... The final construct pVW284 is cloned in a single integration vector URA3 (pSIVu57 Addgene #81089). The PP7 stem loops plasmids are based on the previously published pPOL1 24xPP7sl integrative plasmid19 (Addgene 35196) ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Genomics 2020Quote: Human iPSCs were dissociated to single cells and nucleofected with Cas9-coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid on Amaxa 4D-Nucleofactor program CA-137 (Lonza) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and shINTS7 single clones were established by lentiviral infection with Tet-pLKO-puro vector (Addgene, #21915) containing the respective shRNA sequences (shINTS3 ...
-
bioRxiv - Biophysics 2020Quote: A single and dual knockout guide system was developed in the pX458 backbone (Addgene plasmid # 48138) with guides targeting EMC1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Single CYRI CRISPR A-673 was generated using Lentiviral CRISPR vector (hSpCas9-2A-Puro, Addgene #62988) and selected using 1μg/ml Puromycin (Invivogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... a pair of single guide RNAs (sgRNA) targeting human TROP2 were inserted into lentiCRISPRv2 (Addgene, # 98293) and corresponding oligonucleotides were inserted into the pARv-RFP reporter vector (Addgene ...
-
bioRxiv - Systems Biology 2023Quote: We constructed the third-order sgRNA library in a single barcoded vector (pCRISPR3, AddGene #: 191856-191861) using Golden Gate cloning as described previously with minor modifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... sense and antisense oligonucleotides for a single guide RNA (sgRNA) were cloned into pX330 (Addgene plasmid #42230) (37) ...
-
bioRxiv - Cancer Biology 2020Quote: Single knockouts were generated either using a two-vector Streptococcus pyogenes (Sp) Cas9 system: LentiV_SpCas9_puro (Addgene, 108100) and LRG2.1 backbone (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... single 50 nL stereotactic injections of either AA1-Syn-ChrimsonRtdTomato (Addgene #59171-AAV1; (Klapoetke et al., 2014)) or AAV5-Syn-GFP-Jaws (Addgene #65014-AAV5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Animals received a single dose of AAV8.TBG.null or AAV8.TBG.p21 (5*10^12 units/ml) (Addgene) intravenously allowed 1 week wash-out period on normal diet ...
-
bioRxiv - Microbiology 2023Quote: Expression plasmids for single guide RNA (sgRNA) (pMLM3636 vector, a gift from Keith Joung; Addgene plasmid #43860) targeting an exon within ATG5 genes were transiently transfected into HeLa cells using Lipofectamine LTX with PLUS Reagent (Life technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... The following single-stranded (ss) oligos (IDT) were annealed and cloned into the px458 plasmid (Addgene # 48138) using BbsI and T7 DNA ligase in a one-step digestion-ligation reaction to produce the CRISPR gRNA.
-
bioRxiv - Genetics 2021Quote: ... sgRNAs (single gRNA) expressing plasmid was generated using the pCFD3-dU6:3 gRNA vector (Plasmid ID: #49410, Addgene) as described in (Port et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... A single stranded oligo (IDT) was synthesized containing the sense sequence and then cloned into PX458 (Addgene #48138) and transfected into RPE1 cells ...
-
bioRxiv - Biophysics 2022Quote: ... We cloned the single-guide RNAs (sgRNAs) targeting the LTR-MS2 reporter into a modified pLCKO (Addgene #73311) to co-express guide RNAs from a hU6 promoter and mCherry from an hPGK promoter ...
-
bioRxiv - Neuroscience 2022Quote: ... Two single guide RNAs (gRNA1: gaacaactcgacttggctga, gRNA2: ggtgggctccatcatgcaac) were inserted together into the pAC-U63-tgRNA (#112811; Addgene) vector with intervening tRNA(F+E ...
-
bioRxiv - Systems Biology 2022Quote: ... Single guide RNAs (sgRNAs) were provided either as gBlocks (IDT technologies)45 with a Cas9 plasmid (Addgene: 62988) or directly as a ribonucleoprotein complex (Cas9 Nuclease ...
-
bioRxiv - Cell Biology 2023Quote: ... CRISPRi libraries (single CRISPRi-v2 library, Non-targeting dual library [Addgene #197348], or EMC2 dual library [Addgene #197349]) were transduced at a multiplicity of infection less than one into 300-330 million K562-CRISPRi-Tet-ON cells containing the appropriate reporter ...
-
bioRxiv - Cell Biology 2022Quote: To generate the PX459 with single guide RNA (sgRNA) sequences, pSpCas9(BB)-2A-Puro (PX459) V2.0 (Ran et al., 2013)(purchased from Addgene) was digested with FastDigest BbsI (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... single guide RNA (GTAATACCTATGAAGAGTAA) was cloned into pX458-pSpCas9(BB)-2A-GFP (gift from Feng Zhang, Addgene plasmid #48138) via BbsI restriction site ...
-
bioRxiv - Developmental Biology 2022Quote: Single-guide RNAs (sgRNAs) construct: Targeting sgRNA were cloned by annealed oligos into the pU6-BbsI-chiRNA (Addgene # 45946) plasmid via the BbsI restriction sites ...
-
bioRxiv - Genomics 2022Quote: ... we utilized CRIPR/Cas9 genome editing system with single guide RNAs (sgRNAs) cloned into SpCas9 px330 plasmid (Addgene, #98750). Three px330-mCherry-sgRNAs vectors were co-transfected into H3.1 and H3.3 sensor cell lines using TransIT-X2 Transfection Reagent (Mirus Bio ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...