Labshake search
Citations for Addgene :
1 - 50 of 191 citations for Resistant Starch Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and pCFJ910 (G418 resistant; Addgene #44481) (gifts of Erik Jorgensen ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was constructed by replacing puromycin resistant gene with blasticidin resistant gene of LentiCRISPR V2 plasmid (Addgene, #52961). The oligo sequences used to clone into CRISPR vector are ...
-
bioRxiv - Systems Biology 2019Quote: ... and pKLV-PGKpuro2ABFP (puromycin resistant, Addgene, Plasmid #122372) using Lipofectamine 3000 (Cat# L3000015 ...
-
bioRxiv - Cell Biology 2023Quote: ... using Grant lab modified versions of MiniMos enabled vectors pCFJ1662 (Hygromycin resistant) and pCFJ910 (G418 resistant) (gifts of Erik Jorgensen, University of Utah, Addgene #51482): pCFJ1662 Pmec7 GTWY mNeonGreen let858 (34F6 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RNAi-resistant (RR) version of NRF2 (Addgene #136522) was prepared by introducing four silent mutations into the sequence targeted by shNRF2 #1 in pEN_TT 3xFLAG-NRF2 (Addgene #136527) ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or pLenti6-mCherry-H2B (Addgene ID #89766, blasticidin-resistant) were transfected into HEK293T cells as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... coli with lambda phosphatase spectinomycin-resistant plasmid (Addgene plasmid #79748). We used either wild-type ...
-
bioRxiv - Cell Biology 2020Quote: ... OsTIR1 and the puromycin-resistant cassette in pBABE TIR1-9myc (Addgene, 64945) were replaced with ARF16-PB1-HA-P2A-OsTIR1 from pMGS46 (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104433 ...
-
bioRxiv - Molecular Biology 2022Quote: ... NOL7 siRNA-resistant cDNA was subcloned into the pLX301 vector (Addgene, 25895) containing an N-terminal HA epitope tag with an LR reaction (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: The siRNA-resistant CPAP cDNA containing plasmid was obtained from Addgene (#46390). Full-length and C-terminal coding sequences (residues 895-1338 CP3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Guides were cloned into puromycin-resistant pLenti-CRISPRV2 (Addgene; catalog no. 49535) as described in (Sanjana et al. ...
-
An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal stem cellsbioRxiv - Cell Biology 2023Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid #104433 ...
-
bioRxiv - Immunology 2022Quote: ... we used a lentiviral plasmid expressing ACE2 and the puromycin resistant gene (Addgene #145839 ...
-
bioRxiv - Cell Biology 2023Quote: pCP (expression plasmid of the puromycin-resistant gene and Cas9, Addgene plasmid #204743) was derived from PX459 V2.0 (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-p50 were cloned into a puromycin-resistant lentiviral vector (Addgene #114021) using Gibson assembly ...
-
bioRxiv - Biochemistry 2023Quote: ... a Blasticidin (BSD) resistant CryC plasmid was generated by replacing spTN from Addgene plasmid #153002 (Cho et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... using Grant lab-modified versions of MiniMos enabled vectors pCFJ1662 (Hygromycin resistant; Addgene #51482) and pCFJ910 (G418 resistant ...
-
bioRxiv - Synthetic Biology 2024Quote: Phagemid-containing supernatants were added to 2.5 mL S2060 cells (streptomycin-resistant, Addgene #105064) grown to OD600 = 0.5 and allowed to infect at 37 °C and 250 rpm for 1 h ...
-
bioRxiv - Genetics 2021Quote: ... linearized hygromycin resistant lentiviral vector lenti MS2-P65-HSF1_Hygro (Addgene 61426, (Konermann et al. 2015)) by using the In-Fusion HD Cloning Kit (Takara Bio).
-
bioRxiv - Cancer Biology 2020Quote: ... Blasticidin-resistant cells were subsequently transduced with viral supernatant containing LentiGuide-Puro plasmid (Addgene plasmid #52963) with ligated selected sgRNA ...
-
bioRxiv - Plant Biology 2023Quote: ... and E04 were transformed with tetracycline (Tet) resistant plasmids pSW002-PpsbA-DsRed-Express2 (DsRed; Addgene, 111257) via electroporation (Supplemental Methods S1) ...
-
bioRxiv - Biophysics 2019Quote: ... The full-length rsFolder cDNA was cloned in the ampicillin-resistant expression plasmid pET15b (Addgene, Teddington, UK), and constructs were designed to bear a six-residue N-terminal His-tag linked to the protein coding region via a Thrombin cleavage sequence ...
-
bioRxiv - Microbiology 2021Quote: CRISPR-LbCpf1/SpCas9 plasmid was constructed based on the streptomycin-resistant plasmid DS-SPCas (Addgene no. 48645) as described previously21 ...
-
bioRxiv - Molecular Biology 2022Quote: ... A puromycin resistant gene unit was amplified from plasmid pGL3-U6-sgRNA-PGK-puromycin (Addgene, Watertown, MA) by PCR and the 1473 bp product was then inserted in an EcoRV site in intron 19-20 ...
-
bioRxiv - Cell Biology 2022Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104433 ; http://n2t.net/addgene:104433; RRID:Addgene_104433)49
-
An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal stem cellsbioRxiv - Cell Biology 2023Quote: ... sg resistant gamma-tubulin was a gift from Maria Alvarado-Kristensson (Addgene plasmid #104433; http://n2t.net/addgene:104433; RRID:Addgene_104433), and pmScarlet_H2A_C1 was a gift from Dorus Gadella (Addgene plasmid #85051 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2435696-24478046) was replaced by the tetracycline resistant gene from the PfoI/EcoRI fragment of pRGD-TcR (Addgene, #74110) (Ledermann et al ...
-
Telomerase deficiency in humans is associated with systemic age-related changes in energy metabolismbioRxiv - Cell Biology 2022Quote: pBABE retroviral vectors on the puromycin-resistant backbone expressing TERT and TERT-HA (Counter et al., 1998) or the empty vector were obtained from Addgene Europe ...
-
bioRxiv - Cell Biology 2022Quote: ... and modified versions of hygromycin-resistant and miniMos-enabled vector pCFJ1662 (gift from Erik Jorgensen, University of Utah; Addgene #51482). pDONR221 entry vectors containing coding regions for rab-5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting XRN1 sg1 and sg2-resistant XRN1 constructs and a GFP control construct were sub-cloned into the pLEX307 lentiviral expression vector (Addgene) under the control of an EF-1α promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs encoding either APC/C resistant (APC/CR) mVenus-cyclin A2 or mVenus-cyclin B1 were cloned into pINDUCER20 (plasmid #44012; Addgene) by replacing the gateway cassette sequence and were synthesized by Twist Biosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...
-
bioRxiv - Cell Biology 2020Quote: Single guide RNAs (sgRNAs) were designed using CRISPR analysis tools on Benchling and cloned into puromycin-resistant pLenti-CRISPRV2 (AddGene #49535) as described in Sanjana et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Guide RNA resistant ORC2 (ORC2gr) was amplified by PCR and cloned into NheI-digested mAID-mCherry2-NeoR plasmid (mAID-mCherry2-NeoR, Addgene 72830) in order to add mAID degron sequence to the N-terminus ...
-
bioRxiv - Cell Biology 2020Quote: ... HeLa cells were transfected with a plasmid that expresses RNAi-resistant ch-TOG:GFP plus a hairpin RNA (sh ch-TOG) to knockdown endogenous protein and minimize overexpression (Addgene ID# 69113). HeLa cells stably expressing GFP:tubulin were previously generated (van Oostende Triplet et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... or sgRNAs targeting different regions within the CDC20 gene (sgM1, TCGAACGCGAACTGTGCCAT; sgExon1, CCTGCACTCGCTGCTTCAGC; sgExon3, CCAGGAA-CATCAGAAAGCCT) were cloned into the sgOpti plasmid (puro-resistant, Addgene #85681) and introduced into the inducible CRISPR/Cas9 HeLa cell line by lentiviral transduction 5 ...
-
bioRxiv - Genomics 2020Quote: ... The VP64 cassette was replaced by CTCF sequences to generate dCas9-CTCF and neomycin resistant marker that was taken from pAC95-pmax-dCas9VP160-2A-neo (a gift from Rudolf Jaenisch, Addgene 48227) was inserted ...
-
bioRxiv - Genomics 2023Quote: ... CROP-seq-opti-Puro-T2A-GFP was assembled by adding a T2A-GFP downstream of Puromycin resistant protein coding sequence on the CROP-seq-opti plasmid (Addgene #106280). Flanking MluI and CsiI digestion sites were added to the GFP Gblock (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... using in house modified versions of hygromycin-resistant and MiniMos enabled vector pCFJ1662 (gift of Erik Jorgensen, University of Utah, Addgene #51482): pCFJ1662 Phyp7 mNeonGreen GTWY let858 (34B2) ...
-
bioRxiv - Cell Biology 2023Quote: pKLV-U6gRNA(BbsI)-PGKblast2ABFP vector was generated by replacing the puromycin resistant gene in pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene plasmid #50946) with blasticidin via Gibson assembly.
-
bioRxiv - Cell Biology 2023Quote: ... and pMRXIB (harboring a blasticidin-resistant marker) (Morita et al., 2018) together with enhanced GFP or mRuby3 (codon-optimized, Addgene #74252). STX17 fragments and their point mutations were generated by a standard PCR method or PCR-mediated site-directed mutagenesis.
-
bioRxiv - Systems Biology 2019Quote: Puromycin-resistant Tet-based inducible cDNA expression system (pSLIK-Puro) was engineered by replacing the hygromycin-resistant gene in pSLIK-Hygro vector (a gift from Iain Fraser, Addgene plasmid # 25737) with a puromycin-resistant gene obtained from lentiGuide-Puro by PCR amplification ...
-
bioRxiv - Cancer Biology 2022Quote: ... or EJ5GFP for NHEJ assay (Addgene, Plasmid 44026) were generated as previously described (20) ...
-
bioRxiv - Cancer Biology 2022Quote: We employed the Traffic Light Reporter assay (Addgene #31482) to look at HR/altNEHJ efficiency ...
-
bioRxiv - Genetics 2021Quote: The Downstream assay vector was based on a pSMART backbone (Addgene plasmid # 49157 ...
-
bioRxiv - Microbiology 2021Quote: Plasmids for luciferase assays were purchased from Addgene (ID: 105494 – 105497) and plasmids for testing interaction in vegetative cells were constructed following previously established protocols (39 ...
-
bioRxiv - Biochemistry 2022Quote: ... PRESTO Tango assay constructs were acquired from Addgene (Cat. no. 1000000068) while the Tango assay constructs were generated based on previously described framework (Barnea et al. ...
-
bioRxiv - Molecular Biology 2023Quote: The following plasmids were purchased from Addgene and used for the RaPID-MS assay: BoxB-plasmid (Addgene #107253); BoxB-EDEN15 plasmid (#107252) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...