Labshake search
Citations for Addgene :
1 - 50 of 808 citations for Recombinant Red Fluorescent Protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Bioengineering 2023Quote: HIS-tagged HER2 (Addgene #16257) was expressed using the Expi293™ expression system (Thermo Fisher ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Cell Biology 2023Quote: ... a monomeric red fluorescent protein (RFP)-FKBP12 (Addgene, Plasmid #67514) (71 ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Cell Biology 2020Quote: ... and 6x-HIS-tagged-HOXB2 (Addgene 8522) were obtained from commercial vendors and cloned into pCMV6 vector and transfected into HEK cells ...
-
bioRxiv - Cell Biology 2019Quote: ... RCC1 was targeted with an infra-red fluorescent protein (IFP2.0 Addgene #54785), TIR1 was targeted with 9 Myc-tag sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Cell Biology 2019Quote: His-tagged ubiquitin construct was obtained from Addgene (plasmid: #18712). siRNA#1 resistant RNF168-mCherry plasmid and RNF168 siRNAs were gift from Jiri Lucas (1) ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Cell Biology 2020Quote: ... Histidine-tagged ubiquitin (pCI-His-hUbi, #31815) and Ha-tagged p62 (HA-p62, #28027) plasmids were purchased from Addgene. DNA constructs corresponding to the mature form of human UBTD1 were subcloned from pEGFP-N1 (Novagen ...
-
bioRxiv - Cell Biology 2020Quote: ... Green fluorescent protein-tagged HIF-1α DM(P402/564A) was generated by inserting the sequence of Clover (Addgene plasmid #40259) behind the myc-tag in the BamHI-digested pCMV-Myc-HIF-1α DM(PP/AA ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Genetics 2019Quote: ... mCherry fluorescent protein marker (Addgene), and ampicillin resistance gene ...
-
bioRxiv - Cancer Biology 2020Quote: ... V5/His-tagged pLenti-puro-LacZ and pLenti-puro-ARID1A were obtained from Addgene.
-
bioRxiv - Synthetic Biology 2022Quote: ... C-terminal His-tagged eGFP plasmid was from our lab stock (Addgene, No. 178422)32 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with tandem mRFP-GFP fluorescent-tagged LC3 (ptfLC3) (Addgene #21074). 24h post-transfection ...
-
bioRxiv - Microbiology 2021Quote: Mycobacterium marinum (ATCC 927) with the pTEC27 plasmid expressing the red fluorescent protein tdTomato (Addgene #30182, http://n2t.net/addgene:30182) (29 ...
-
bioRxiv - Cell Biology 2019Quote: ... The nuclear red fluorescent protein (RFP)-expressing lentiviral construct (LV-RFP) was a gift from Elaine Fuchs (Addgene plasmid # 26001). To infect lentiviruses ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected AAVPHP.eB (1012 vg/ml) encoding a red fluorescent protein fused to an opsin (pAAV-TRE3G-BiPOLES-mKate2 (Addgene # 192579)) to label the membrane of cFos+ neurons ...
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged wild-type and D135S AlkB plasmids were obtained from Addgene (#79050 and #79051) and proteins were purified by a Ni-NTA column followed by cation exchange ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470; inhibition: AAV1-CAG-tdTomato, Addgene #59462). Viral injection volume was scaled by age with 200nL injected at P9 ...
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and subcloned in-line with his-tagged MBP construct (2CT-10 vector, Addgene plasmid #55209). Recombinant MBP-EndoH fusion was expressed in and purified from E ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pBAD expressing fluorescent protein variants (Addgene, UK). Primers used in the assembly of the vectors are listed in SI Table 1.
-
bioRxiv - Biophysics 2022Quote: Fluorescent proteins were obtained from Addgene (https://www.addgene.org/) transfected using 0.2 ug plasmid DNA ...
-
bioRxiv - Biochemistry 2022Quote: Codon optimized plasmids encoding the individual His-tagged PBRM1 bromodomain constructs were received from Nicola Burgess-Brown (Addgene plasmid numbers 38999 ...
-
bioRxiv - Neuroscience 2023Quote: ... dopamine was recorded with a red fluorescent GRABDA sensor (AddGene #140557AAV9-hSyn-GRAB rDA1h), while VTA DA terminals in the NAcc were stimulated for the approximate duration of the offer cue (500-600 ms) ...
-
bioRxiv - Cell Biology 2022Quote: ... mRFP-GFP tandem fluorescent-tagged LC3 (tfLC3) was a gift from Tamotsu Yoshimori (Addgene plasmid # 21074; www.addgene.org/21074)51 ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Molecular Biology 2023Quote: The MCS of pBAD24 (Guzman et al., 1995) was exchanged for the red fluorescent protein (RFP) cassette from pPGC-C (Addgene plasmid # 174580,(Bentham et al., 2021)) flanked by BsaI restriction sites ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Immunology 2020Quote: Plasmids containing fluorescent protein coding sequences mCerulean3-N1 (Addgene # 54730), mAzurite-N1 (Addgene # 54617) ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Genetics 2020Quote: ... and a blue fluorescent protein (BFP) expression cassette (Addgene #36086). The 1kb upstream and 1kb downstream arms were amplified from purified mouse genome from AB2.2 ES cells (ATCC #SCRC-1023 ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: Plasmids encoding fluorescent fusion protein were either purchased from Addgene or constructed in house using ligation (NEB Cat# M2200S ...
-
bioRxiv - Cell Biology 2023Quote: ... and enhanced green fluorescent protein (eGFP) (Addgene, Boston, MA, USA). Cells were nucleofected using the Amaxa 4D-Nucleofector (Lonza ...
-
bioRxiv - Biophysics 2024Quote: The expression plasmid for HIS-tagged AavLEA1 was obtained from the Addgene plasmid repository [pET15b-AavLEA1 was a gift from Claude Férec (Addgene plasmid # 53093)]52 The expression plasmid for HIS-tagged RvLEAMshort was made by inserting a truncated cDNA from pEThT-RvLEAM49 [pEThT-RvLEAM was a gift from Takekazu Kunieda (Addgene plasmid # 90033)] ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting chimera genes for the light chain and the His-tagged heavy chain of the Fabs were separately cloned into the pCAGEN vector (a gift from Connie Cepko (Addgene plasmid #11160)) 34 ...
-
bioRxiv - Biochemistry 2020Quote: ... coli RP hk339-GFP (monomeric His-tagged Kif5B kinesin motor domain) expression plasmid was a gift from Ron Vale (Addgene plasmid #24431).
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-tagged Rabaptin5 and YFP-tagged Arf6 were from Addgene. Flag-ErbB3 cDNA was subjected to site-directed mutagenesis (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: For validation experiments we introduced the fluorescent protein EBFP2 (source: Addgene 54665) driven by the dpse enhancer and the CG13116 promoter in the RD-seq plasmid backbone to be able to gate for transfected cells in flow cytometry (Suppl ...
-
bioRxiv - Neuroscience 2024Quote: Enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1) was commercially purchased (Addgene). The fluorescent protein mKate was inserted into a pcDNA3.1(- ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...