Labshake search
Citations for Addgene :
1 - 50 of 1104 citations for Recombinant Human CD28 protein Biotin labelled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Biophysics 2023Quote: CD28 gene (truncated at R185) was amplified from a commercially available plasmid (pEF6a-CD28-PafA, Addgene, #113400) and inserted into the plasmid pcDNA3.1-ChR2WT-mEos3.2 instead of ChR2 gene using BamHI and NotI restriction sites.
-
bioRxiv - Immunology 2021Quote: Recombinant HA (rHA) proteins were expressed using the pcDNA 3.1+ plasmid (Addgene, Watertown, MA). Each HA gene was truncated by removing the transmembrane (TM ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: ... Brunello library targeting all human protein-coding genes28 was purchased from Addgene (#73179). Quality of the MYC-CRISPR and Brunello libraries was verified by next-generation sequencing on Illumina platform (BGI ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Cell Biology 2023Quote: Plasmids encoding recombinant WT (RRID:Addgene_92100) and M880A mutant human GST-TAF3-PHD were kindly provided by Albert Jeltsch (Kungulovski et al. ...
-
bioRxiv - Genetics 2020Quote: Cas9 recombinant protein was expressed in Escherichia coli BL21 (DE3) from plasmid pMJ915 (a gift from Jennifer Doudna; Addgene # 69090) and purified as previously described (34) ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression plasmid for Ism1 with C-terminal myc-6xhis tag plasmid for recombinant Ism1 protein production was from Addgene (#173046).
-
bioRxiv - Plant Biology 2021Quote: ... and Cas9 RNP nucleofection were performed according to Huang et al.30 Cas9 recombinant protein was overexpressed in Escherichia coli BL21 harboring the plasmid pMJ915 (Addgene # 69090). Cas9 protein was purified and stored at −80°C in Cas9 RNP buffer (20 mM HEPES at pH 7.5 ...
-
bioRxiv - Immunology 2021Quote: ... The construct was cloned into an MSGV CD28-CD3z CAR retroviral vector (Addgene #107226). Briefly ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Biophysics 2019Quote: The cDNAs for protein expression in this study were as follows: human Tau-2N4R (Addgene #16316), human MAP7 (GE Dharmacon MGC Collection #BC025777) ...
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant strains harbouring pTEC19 plasmid (Addgene, #30178) and producing the fluorescent protein E2-Crimson were grown in Middlebrook 7H9 broth supplemented with 0.2% glycerol (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... hLamp1-BFP (#1016) plasmid encoding BFP-labeled version of human Lamp1 protein was from Addgene (Cat# 98828). GFP-hRab14.dn3 (#1017) ...
-
bioRxiv - Microbiology 2019Quote: ... H99 was labelled with mCherry by integrating plasmid pH3mCHSH2 (Addgene) into the so-called Safe-Haven 2 (SH2 ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid expressing the human ACE2 protein with a C-terminal C9 tag was obtained from Addgene (Plasmid 1786). 293T cells were transduced with retroviral particles carrying a pQCXIP vector encoding the gene for the human ACE2 protein ...
-
bioRxiv - Cell Biology 2021Quote: ... The mCh-hRab7A (#922) plasmid encoding mCherry-labeled version of human Rab7A protein was from Addgene (Cat# 61804). GFP-hRab5A.dn3 (#966) ...
-
bioRxiv - Cell Biology 2021Quote: The RFP-hRab5A.dn3 (#921) plasmid encoding RFP-labeled version of human Rab5A protein was from Addgene (Cat# 14437). The mCh-hRab7A (#922 ...
-
bioRxiv - Cell Biology 2024Quote: ... We next used the human EZH2 primary protein sequence available in the addgene for hEZH2 plasmid (#24230, Addgene) and predicted the possible cysteine residues using the GPS-SNO prediction tools ...
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Biochemistry 2022Quote: ... was made by ligating a PCR fragment encoding full-length human protein between ApaI and BamHI sites of pHis10-PS-SNAPf (75) (gift from Ron Vale; Addgene plasmid #78512 ...
-
bioRxiv - Biophysics 2019Quote: Expression of N-terminally acetylated human αS and βS proteins was performed via co-expression with pNatB plasmid (Addgene #53613) in E ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-hRab31.dn3 (#1019) plasmids encoding GFP-labeled versions of the indicated human wild-type proteins were from Addgene (Cat# 49549 ...
-
bioRxiv - Neuroscience 2023Quote: ... An AAV8 encoding the inhibitory designer receptor KORD fused to the fluorescent protein mCitrine under the control of the human synapsin promoter in a Cre-dependent manner was obtained from Addgene (AAV8-hSyn-dF-HA-KORD-IRES-mCitrine ...
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2022Quote: ... 250nl of an anterograde adeno-associated virus (AAV) vector expressing a green fluorescent protein under the hSyn (human synapsin) promoter (AAV5-hSyn-eGFP; Addgene) was injected into ACC to fluorescently mark the anatomical boundary of the claustrum (White et al. ...
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Bioengineering 2023Quote: ... GFP-labelled cells were generated by infecting them with GFP lentivirus (Addgene 17448).
-
bioRxiv - Cell Biology 2020Quote: ... human KLF4 (RRID:Addgene_17219), human c-MYC (RRID:Addgene_17220 ...
-
bioRxiv - Cell Biology 2020Quote: ... human SOX2 (RRID:Addgene_17218), human KLF4 (RRID:Addgene_17219) ...
-
bioRxiv - Neuroscience 2022Quote: ... human DNAJB4 (Addgene) and DNAJB6 (Addgene ...
-
bioRxiv - Biophysics 2022Quote: ... and pET21a-BirA (Biotin Ligase) was a gift from Alice Ting (Addgene plasmid # 20857 ...