Labshake search
Citations for Addgene :
1 - 50 of 1512 citations for Recombinant Human 5' Nucleotidase Ecto CD73 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: HIS-tagged HER2 (Addgene #16257) was expressed using the Expi293™ expression system (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Cell Biology 2020Quote: ... and 6x-HIS-tagged-HOXB2 (Addgene 8522) were obtained from commercial vendors and cloned into pCMV6 vector and transfected into HEK cells ...
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Cell Biology 2019Quote: His-tagged ubiquitin construct was obtained from Addgene (plasmid: #18712). siRNA#1 resistant RNF168-mCherry plasmid and RNF168 siRNAs were gift from Jiri Lucas (1) ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Cell Biology 2020Quote: ... Histidine-tagged ubiquitin (pCI-His-hUbi, #31815) and Ha-tagged p62 (HA-p62, #28027) plasmids were purchased from Addgene. DNA constructs corresponding to the mature form of human UBTD1 were subcloned from pEGFP-N1 (Novagen ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Cancer Biology 2020Quote: ... V5/His-tagged pLenti-puro-LacZ and pLenti-puro-ARID1A were obtained from Addgene.
-
bioRxiv - Synthetic Biology 2022Quote: ... C-terminal His-tagged eGFP plasmid was from our lab stock (Addgene, No. 178422)32 ...
-
bioRxiv - Cell Biology 2020Quote: ... VSV-G-tagged human Lrp6 was obtained from Addgene (27282), amplified by PCR using primers containing Gateway sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged wild-type and D135S AlkB plasmids were obtained from Addgene (#79050 and #79051) and proteins were purified by a Ni-NTA column followed by cation exchange ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and subcloned in-line with his-tagged MBP construct (2CT-10 vector, Addgene plasmid #55209). Recombinant MBP-EndoH fusion was expressed in and purified from E ...
-
bioRxiv - Developmental Biology 2019Quote: ... and HA-tagged human Snai1 (clone 31697) were purchased from Addgene. Full-length cDNA clones for human DDX3X (Accession ...
-
bioRxiv - Biophysics 2023Quote: Histidine-tagged human RAD52 FL (RAD52 FL) expression vector (pET15b; Addgene) was transformed in E ...
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids encoding the human UBF gene tagged with EGFP and nucleolin gene tagged with EGFP were obtained from Addgene (plasmids # 26672 and #28176 ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Biochemistry 2022Quote: Codon optimized plasmids encoding the individual His-tagged PBRM1 bromodomain constructs were received from Nicola Burgess-Brown (Addgene plasmid numbers 38999 ...
-
bioRxiv - Neuroscience 2022Quote: ... The V5-tagged human GLUT1 construct was a gift from Wolf Frommer (Addgene) 89 ...
-
bioRxiv - Cancer Biology 2020Quote: ... FLAG-tagged human EZHIP was cloned into the pMT-puro vector (Addgene #17923). Transfections were performed with 2 μg plasmid DNA ...
-
bioRxiv - Cell Biology 2023Quote: A vector expressing HA-tagged human E6AP was obtained from Addgene (Plasmid #8658), E6AP mutants were generated using site-directed mutagenesis (Agilent ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... An amino-terminal 3xFlag epitope tagged human GLUT3 was generated by PCR (Addgene #72877) (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmids for the expression of myc-tagged human ACE2 (pCEP4-myc-ACE2, Addgene No. 141185), 8his-tagged monomeric sACE2 (ACE2 a.a ...
-
bioRxiv - Biophysics 2024Quote: The expression plasmid for HIS-tagged AavLEA1 was obtained from the Addgene plasmid repository [pET15b-AavLEA1 was a gift from Claude Férec (Addgene plasmid # 53093)]52 The expression plasmid for HIS-tagged RvLEAMshort was made by inserting a truncated cDNA from pEThT-RvLEAM49 [pEThT-RvLEAM was a gift from Takekazu Kunieda (Addgene plasmid # 90033)] ...
-
bioRxiv - Cell Biology 2022Quote: Human PFKFB3 tagged with N-terminal GFP was cloned into the viral plasmid pWPXL (Addgene #12257). A PFKFB3 mutant (nuc-free PFKFB3 ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminal HA-tagged full-length pCGN-ATF6-N plasmid came from Addgene (catalog #: 11974, human). The XBP1s plasmid was a kind gift from Dr ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting chimera genes for the light chain and the His-tagged heavy chain of the Fabs were separately cloned into the pCAGEN vector (a gift from Connie Cepko (Addgene plasmid #11160)) 34 ...
-
bioRxiv - Biochemistry 2020Quote: ... coli RP hk339-GFP (monomeric His-tagged Kif5B kinesin motor domain) expression plasmid was a gift from Ron Vale (Addgene plasmid #24431).
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-tagged Rabaptin5 and YFP-tagged Arf6 were from Addgene. Flag-ErbB3 cDNA was subjected to site-directed mutagenesis (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... Flag-tagged full-length Human gamma-catenin construct in the pcDNA3 vector was obtained from Addgene (plasmid #16827).
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid expressing FLAG-tagged wild-type human HDAC1 was a gift from Eric Verdin (Addgene Plasmid # 13820). HCT116 cells were transfected in 10 cm plates with 8 μg plasmid and 40 μl PEI ...
-
bioRxiv - Cancer Biology 2022Quote: CD73 gene-editing was generated by electroporation of all-in-one CRISPR/Cas9 vector (px330, Addgene) expressing the 20mer target sequence GCAGCACGTTGGGTTCGGCG (exon1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... a mammalian expression vector pRK5 encoding EGFP tagged wild-type (WT) human tau (pRK5-EGFP-tau, # 46904, RRID: Addgene_46904), which contains four C-terminal repeat regions and lacks the N-terminal sequences (0N4R) ...
-
bioRxiv - Neuroscience 2023Quote: Wild type Drosophila and human spectrins were cloned into a histidine tagged vector (2BC-T cloning vector, Addgene # 31070) using ligation independent cloning to obtain C-terminally tagged proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... pEZYmyc-His (Addgene plasmid #18701 ...
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...