Labshake search
Citations for Addgene :
1 - 50 of 647 citations for Rat Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Microbiology 2020Quote: Plasmids for lentiviral transduction (pLJM1-2xStrep or untagged wild-type ORF68, mutants, and homologs) (Addgene #x-x) were generated by subcloning into the AgeI and EcoRI sites of pLJM1 modified to confer resistance to zeocin (Addgene #19319 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Biochemistry 2022Quote: ... For experiments in Drosophila a pUAST-attB plasmid encoding drosophila Src homolog isoform A (Src42A) was cloned by amplifying Src42A codifying sequence from a pGEX-Src42A donor plasmid (Addgene #126673) using primers with EcoRI (forward 5′-CTGAATAGGGAATTGGGAATTCATGGGTAACTGCCTCACC-3′ ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chimeras of the minimal domain (NTD) ORF24 homologs with ORF24 202-752 were generated using two-insert InFusion cloning (Addgene #138453-138455) into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag).
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x). Mutations in ORF68 (Addgene #x-x ...
-
bioRxiv - Cancer Biology 2021Quote: ... its coding sequence transcript (GenBankTM accession number NM_001134473.3) was cloned into the pLEX_307 (Addgene, #41392) and the pLEX_306 (Addgene ...
-
bioRxiv - Physiology 2023Quote: ... containing endothelial specific-promoter (CDH5, VE-Cadherin) and green fluorescent protein (GFP) and the plasmid pC4-RhE-FRB-Fis1 (Addgene Cat# 68056) containing human Fis1 gene were purchased from Addgene ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Cell Biology 2020Quote: ... carrying specific oligonucleotides and psPAX2 (#52961; Addgene) and pLP-VSVG (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Cell Biology 2024Quote: ... They were used in conjunction with a Cas9 expression vector containing neomycin (G418) resistance transcript (Addgene #98292). H293T cells were transfected with lentivirus packaging plasmids and plasmids carrying either sgRNAs or Cas9 ...
-
bioRxiv - Molecular Biology 2019Quote: Full length wild type human DHX30 cDNA corresponding to transcript (ENST00000348968.8) was cloned into the TetON lentiviral vector pCW57.1 (Addgene), exploiting the Nhe I and Age I restriction endonucleases ...
-
bioRxiv - Molecular Biology 2023Quote: ... The linear transcript used as a negative control consists of GFP expressed from pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene plasmid 12252).
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Cell Biology 2023Quote: ... selection marker and Cas12a-specific crRNA gene (Addgene 120016). PCRs were carried out using HiFi polymerase (Takara Bio UK Ltd ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Neuroscience 2020Quote: The epha4b cryptic transcript was amplified from cDNA and inserted into the multi-cloning site of plasmid pCS2+ (Addgene). The in-vitro transcription reaction was performed on linearized plasmid using the mMessage mMachine SP6 Transcription Kit (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... a 6.6 kb genomic fragment of the nhr-49 gene (including a 4.4 kb coding region covering all nhr-49 transcripts and a 2.2 kb promoter region) was cloned into the GFP expression vector pPD95.77 (Addgene #1495), as reported previously (Ratnappan et al. ...
-
bioRxiv - Microbiology 2020Quote: ... a 6.6 kb genomic fragment of nhr-49 gene (comprising of 4.4 kb coding region covering all nhr-49 transcripts plus 2.2 kb sequence upstream of ATG) was cloned into the GFP expression vector pPD95.77 (Addgene #1495), as reported previously (Ratnappan et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Presynaptic rat neurexin1a was obtained from Addgene #58266 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Immunology 2022Quote: ... CAR-specific domains were removed from pSLCAR-CD19 (Addgene #135992), leaving a linearized plasmid containing a short EF1a promoter and a P2A-NeonGreen reporter sequence ...
-
bioRxiv - Developmental Biology 2023Quote: Human LSM14A-GFP (Ensembl Transcript ID: ENST00000544216.8) were cloned into FUW-tetO-loxP vector (was a gift from Rudolf Jaenisch lab, Addgene #60849) via Gibson assembly ...
-
bioRxiv - Physiology 2024Quote: cDNA of the canonical NR4A3 transcript (NR4A3-203; NM_006981.4) was synthesised into a modified pLenti CMV Puro DEST (w118-1) vector (Addgene plasmid #17452) by GENEWIZ (Azenta Life Science ...
-
bioRxiv - Cell Biology 2023Quote: ... AP2µ2(rat)-mCherry was obtained from Addgene (#27672).
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Bioengineering 2020Quote: ... The construction of PEgRNA transcript carrying plasmid: The empty PEgRNA plasmid was modified from the pgRNA-bacteria (ColE1 ori, Addgene plasmid #44251)30 by removing the 20 bp spacer ...
-
bioRxiv - Genomics 2020Quote: ... Target-specific oligonucleotides were cloned into the pSpCas9-GFP plasmid (Addgene PX458) using BbsI restriction digestion ...
-
bioRxiv - Neuroscience 2019Quote: ... The sequence-specific sgRNA template was generated in a pDR274 vector (Addgene Plasmid #42250 ...
-
bioRxiv - Neuroscience 2021Quote: Astrocytic-specific GCaMP6f expression was obtained using pZac2.1 gfaABC1D-cyto-GCaMP6f (Addgene viral prep # 52925-AAV5 a gift from Dr ...
-
bioRxiv - Cancer Biology 2019Quote: ... we inserted a TRIM28 specific gRNA sequence (GGCCCCCGGCGGCGTGTGAA) into pLentiCRISPRv2 (#52961, Addgene). For CRISPRi we inserted gRNA sequences into pLV-hU6-sgRNA-hUbC-dCas9-KRAB-T2a-Puro (#71236 ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Neuroscience 2023Quote: ... To introduce the domain-specific protospacer sequences into the pCFD4 vector (Addgene), we employed the ligation-independent Gibson Assembly method (NEBuilder ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gene-specific gRNAs were integrated into pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) and 2 μg of plasmid was electroporated into 106 cells using a Lonza 4D-NucleofectorTM according to the manufacturer’s protocol for HCT116 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... Autophagosome-specific marker mCherry-hLC3B-pcDNA3.1 was a gift from David Rubinsztein (Addgene plasmid # 40827 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral gene-specific shRNAs were prepared in pLKO.1-puro backbone (Addgene # 8453) (identified from verified sequences at https://www.sigmaaldrich.com/US/en/product/sigma/shrna ...
-
bioRxiv - Cancer Biology 2023Quote: ... Specific shRNA oligonucleotides targeting USP39 were cloned into the pLL3.7 lentiviral vector (Addgene). These plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: Gene-specific sgRNAs were cloned into the pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP (Addgene #67974) lentiviral backbone ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Neuroscience 2022Quote: ... rats received injections of AAV5.CMV.HI.eGFP-Cre.WPRE.SV40 (Addgene #105545, 0.3μl). In the Pf (females ...
-
bioRxiv - Physiology 2020Quote: ... The tissue-specific CapaR CRISPRKO construct was cloned into pCFD6 vector (www.crisprflydesign.org, Addgene #73915) according to the website’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gene-specific gRNAs were integrated into pSpCas9(BB)-2A-GFP (PX458) (Addgene no. 48138) and 2μg of plasmid was electroporated into 106 cells using a Lonza 4D-Nucleofector according to the manufacturer’s protocol for HCT116 cells ...
-
bioRxiv - Cell Biology 2020Quote: Mammalian expression plasmids encoding rat LAMP1 (mCherry-Lysosomes-20, Addgene; 55073), mApple-LAMP1-pHluorin (Addgene ...
-
bioRxiv - Immunology 2021Quote: ... and the third exon of NCR3 (conserved in 3 of the 4 longest isoforms of NCR3 with transcript ID ENST00000376073) were designed and cloned into the lentiCRISPR V2 vector (Addgene #52961, sgRNA sequences in Table S1). Lentiviruses were produced in HEK293T cells using standard laboratory protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... multiple gene-specific gRNAs were combined and co-transfected with pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A PAR2 specific guide (CCCCAGCAGCCACGCCGCGC) was cloned into the lentiCRISPR v2 plasmid (Addgene plasmid # 52961). 48 hours after transfection ...