Labshake search
Citations for Addgene :
1 - 50 of 1935 citations for Rat Eukaryotic Translation Initiation Factor 4E Binding Protein 1 EIF4EBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Synthetic Biology 2021Quote: ... to specifically target TP53 translation stop site and it was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene #71707) according to the protocol of Ran et al.51 ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Biochemistry 2022Quote: ... All expression constructs were in the form containing an N-terminal His6 and maltose-binding protein (MBP) tag (Addgene #11517).
-
bioRxiv - Cell Biology 2023Quote: ... polyspora Hop1319-529 into UC Berkeley Macrolab vectors to generate N-terminal TEV protease-cleavable His6- or His6-maltose binding protein tags (Addgene #29666, 29706). DNA binding mutants of S ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Bioengineering 2022Quote: ... The T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter SuperTopFlash (STF) and the control pRL-SV40 Renilla luciferase constructs (Addgene) were used for Wnt/β-catenin-responsive reporter assays ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FOP flash (mutated TCF binding sites; Addgene#12457) luciferase expression vectors and with Renilla luciferase vector (control ...
-
bioRxiv - Molecular Biology 2020Quote: ... At least two independent sets of oligonucleotide pairs for gene knockdown of human MTs and the transcription factor MTF-1 (supplementary table S4) were synthesized and cloned into the pLKO.1-TCR vector (Addgene, Cambridge, MA, USA); the same vector was also used as an empty vector control ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Cell Biology 2023Quote: ... or MRE plasmid with mutated TCF binding sites (Addgene, 12457), together with 100 ng of the Renilla luciferase control plasmid (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting genomic region immediately upstream of the translation stop codon of Sox2 or Sox15 was cloned into LentiCRISPRv2 vector (Addgene). Single-stranded (ss ...
-
bioRxiv - Biochemistry 2021Quote: sgRNA targeting genomic region immediately downstream of the ATG translation start codon of ABCF1 was cloned into LentiCRISPRv2 vector (Addgene). A single-stranded (ss ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: An sgRNA targeting the MDC1 gene around the ATG translation start site was cloned in pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). The plasmid was then transfected into HEK-293T cells along with a single stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Molecular Biology 2021Quote: ... we generated guide RNAs targeting a site close to the putative translation start site and cloned into the pX330 vector using BbsI (Addgene 42230), as summarized in Table S3 ...
-
bioRxiv - Molecular Biology 2023Quote: An sgRNA targeting the ZFC3H1 gene around the ATG translation start site was cloned in pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). The plasmid was then transfected into HEK-293T cells along with a single stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... Presynaptic rat neurexin1a was obtained from Addgene #58266 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNA binding sequence (AAGAGGTACGTACAGGTACT) was inserted into the vector pDD162 (from Addgene) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... AP2µ2(rat)-mCherry was obtained from Addgene (#27672).
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Neuroscience 2024Quote: The transcription factors and the reverse tetracycline transactivator (rtTA) were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all TF binding site and mKate sequences were derived from SPECS plasmids (Addgene #127842). The NFAT response element was subcloned from the pSIRV-NFAT-eGFP plasmid68 (a gift from Peter Steinberger ...
-
bioRxiv - Genomics 2021Quote: ... Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). PUF9R-tethered iRFP670 and mRuby2 were created by a combination of PCR (from IDT gBlocks ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reporter constructs contained 14 UAS sites for Gal4-DBD binding (source: Addgene 128010), an enhancer and a core promoter ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (wt p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442). The DNA polymerase used was Phusion High Fidelity (cat# E0553S ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Genomics 2020Quote: pNTI729 was constructed by first amplifying the ZEM transcription factor from pNTI638 (pHES795 Addgene #87943) (17 ...