Labshake search
Citations for Addgene :
1 - 50 of 835 citations for Rat Aflatoxin B1 Aldehyde Reductase Member 3 AKR7A3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... xylose reductase (XYL1, Addgene ID 195016), terminator from Agrobacterium tumefaciens nopaline synthase (tNOS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid pET-TRSter for heterologous expression of human thioredoxin reductase (hTrxR) was purchased from Addgene. Plasmids for wt and mutant DJ-1 were obtained from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... Plexin B1 cytoplasmic tail (aa 1512-2135) (PLXNB1, Addgene 25252), mouse Roundabout homolog 1 cytoplasmic tail (aa 880-1612 ...
-
bioRxiv - Biochemistry 2022Quote: ... by Gateway LR reactions (Resulting pAG416GPD-PpMAX1c). Then these constructs were co-transformed with ATR1 (NADPH-CYP reductase 1 from A. thaliana) expression vector (Addgene, Catalog # 178288) into the Saccharomyces cerevisiae wild-type strain CEN.PK2-1D using the Frozen-EZ yeast transformation II kit (Zymo Research ...
-
bioRxiv - Biophysics 2021Quote: ... The mCherry-lamin B1-10 was a gift from Michael Davidson (Addgene plasmid #55069). GFP-tagged rat connexin-43 was generated earlier [25] ...
-
bioRxiv - Molecular Biology 2020Quote: ... expressed from separate promoters (pDual SR-B1 or CD81, available from Addgene: https://www.addgene.org/Joe_Grove/). Supernatants containing viral vectors were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the two fragments of FlipGFP B1-9 and B10-E5-B11-TEVcs-K5 were amplified from Addgene Plasmid #124429 via PCR ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Cell Biology 2019Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat Myo1b (Plasmid #135064, Addgene) C-terminal Myc-tag ...
-
bioRxiv - Cell Biology 2021Quote: pTRIP-SFFV-EGFP-NLS and the coding sequences of mEmerald-Lamin A/C and mEmerald-Lamin B1 were from Addgene. pLVX-N-GFP was a kind gift from Prof ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs encoding either APC/C resistant (APC/CR) mVenus-cyclin A2 or mVenus-cyclin B1 were cloned into pINDUCER20 (plasmid #44012; Addgene) by replacing the gateway cassette sequence and were synthesized by Twist Biosciences ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Neuroscience 2020Quote: ... Presynaptic rat neurexin1a was obtained from Addgene #58266 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Cell Biology 2023Quote: ... AP2µ2(rat)-mCherry was obtained from Addgene (#27672).
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Neuroscience 2022Quote: ... rats received injections of AAV5.CMV.HI.eGFP-Cre.WPRE.SV40 (Addgene #105545, 0.3μl). In the Pf (females ...
-
bioRxiv - Molecular Biology 2019Quote: ... were cloned via BpiI into pX330S-2 and pX330S-3 (Sakuma et al., 2014) and a third vector pGEP179_pX330K (this study) according to kit instructions (Addgene Kit#1000000055, Sakuma et al., 2014). The pGEP179_pX330K plasmid is a modified entry vector generated by cloning the BsaI-pU6-sgRNA-BsaI fragment from pX330A-1×3 (Sakuma et ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Cell Biology 2020Quote: Mammalian expression plasmids encoding rat LAMP1 (mCherry-Lysosomes-20, Addgene; 55073), mApple-LAMP1-pHluorin (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...
-
bioRxiv - Neuroscience 2022Quote: ... ChAT-Cre or WT rats were injected with pAAV5-hSyn-mCherry (Addgene) at a titer of 1.4-2.8×1013 GC/mL.
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...