Labshake search
Citations for Addgene :
1 - 50 of 614 citations for Rabbit S100 Calcium Binding Protein A6 S100A6 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Neuroscience 2021Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA) to drive expression preferentially in principal neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: The calcium indicator GCaMP6s (Addgene 40753, MA) (32 ...
-
bioRxiv - Microbiology 2022Quote: ... and a non-targeting guide (A5 and A6, [79]) were annealed and ligated into lentiCRISPRv2 (a generous gift from Jan Carette, Stanford University, Addgene, plasmid no. 52961). Plasmids were subsequently sequenced to confirm correct inserts A22 and 3CMVFW (Sequetech.com ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Neuroscience 2020Quote: ... Optogenetic and calcium imaging plasmids were obtained from Addgene (ChRoME15 ...
-
bioRxiv - Neuroscience 2023Quote: ... Expression of the calcium indicator GCaMP7f (Addgene, AAV1.Syn.GCaMP7f.WPRE.SV40) was achieved by stereotaxic injection of AAV virus ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Biochemistry 2022Quote: ... All expression constructs were in the form containing an N-terminal His6 and maltose-binding protein (MBP) tag (Addgene #11517).
-
bioRxiv - Neuroscience 2020Quote: ... carrying the fluorescent calcium indicator GCaMP6f (AAV.Syn.Flex.GCaMP6f.WPRE.SV40, 1E13 particles/ml, Addgene) into the left VTA (AP ...
-
bioRxiv - Bioengineering 2022Quote: ... for calcium imaging or pAAV-Syn-Archon1-KGC-GFP-ER2 (Addgene) for voltage imaging ...
-
bioRxiv - Cancer Biology 2022Quote: ... Calcium phosphate transfection was used to generate EGFR-G719C (Addgene 116254), EGFR-L858R (Addgene 11012) ...
-
bioRxiv - Neuroscience 2023Quote: ... We expressed mammalian cDNAs encoding calcium-channel e37a-Cacna1b (Addgene: 26569) and e37b-Cacna1b (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... an AAV encoding the calcium indicator GCaMP6s (AAV2-hSyn-GCaMP6s; Addgene) was injected.
-
bioRxiv - Cell Biology 2023Quote: ... polyspora Hop1319-529 into UC Berkeley Macrolab vectors to generate N-terminal TEV protease-cleavable His6- or His6-maltose binding protein tags (Addgene #29666, 29706). DNA binding mutants of S ...
-
bioRxiv - Immunology 2023Quote: ... Calcium reporter jGCaMP7s sequence was amplified from pGP-CMV-jGCaMP7s (104463, Addgene) and cloned into pBOB plasmid by LIC ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Neuroscience 2023Quote: ... and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40) (Addgene, titer ≥ 1×10¹³ vg/mL) were mixed in a 1:1 ratio and vortexed immediately prior to intracranial infusion surgeries.
-
bioRxiv - Neuroscience 2023Quote: ... Calcium imaging experiments were performed with AAV1-Syn-FLEX-jGCaMP7f (Addgene 104492-AAV1) for M1CT neurons or AAVretro-hSyn-FLEX-jGCaMP7f (Addgene 104492-AAVrg ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FOP flash (mutated TCF binding sites; Addgene#12457) luciferase expression vectors and with Renilla luciferase vector (control ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus was generated in 293T cells by calcium phosphate cotransfection with psPAX2 (Addgene #12260), pCMV-VSV-g (Addgene #8454) ...
-
bioRxiv - Neuroscience 2022Quote: ... a calcium indicator AAV9-hSyn-GCAmp6f-eYFP (Addgene, viral titer 2.8 × 1013 vg/mL) or a control virus AAV9-hSyn-eYFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: Calcium indicator GCaMP6f (AAV1-Synapsin-GCaMP6f-WPRE-SV40, Addgene 100837-AAV1; 6.52 ×1012GC/ml) was injected using the same procedure at 4.5-5 months after injection of AAV-GFAP-htTau or AAV-GFAP-Control ...
-
bioRxiv - Cell Biology 2023Quote: ... or MRE plasmid with mutated TCF binding sites (Addgene, 12457), together with 100 ng of the Renilla luciferase control plasmid (Addgene ...
-
Sexual dimorphism of insular cortex function in persistent alcohol drinking despite aversion in micebioRxiv - Neuroscience 2023Quote: A viral vector coding for the calcium sensor GCaMP6f (AAV9-CaMKII-GCaMP6f-WPRE-SV40, Addgene) was injected unilaterally (250 nl ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Genetics 2021Quote: ... HEK293T cells were transfected using calcium phosphate with psPAX2 (gift from Didier Trono, Addgene No.12260), pCAG-Eco (gift from Arthur Nienhuis and Patrick Salmon ...
-
bioRxiv - Cell Biology 2021Quote: The genetically encoded calcium sensor pRSET-RcaMP1h was a gift from Loren Looger (Addgene plasmid # 42874). The coding sequence of the RcaMP1h sensor was subcloned into the pShuttle vector ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus carried either a red calcium indicator alone (7 mice; jRGECO1a; AAV1.Syn.NES.jRGECO1a.WPRE.SV40; a gift from Douglas Kim & GENIE Project (Addgene plasmid # 100854 ...
-
bioRxiv - Neuroscience 2023Quote: ... a viral vector for the expression of the genetically encoded calcium indicator GCaMP6f (pAAV.Syn.GCaMP6f.WPRE.SV40, Cat. Number #100837-AAV1, titre 1.3 x 1013, Addgene 95) was injected stereotaxically (Kopf ...
-
bioRxiv - Neuroscience 2024Quote: ... cultures in both chambers were infected with the genetically encoded calcium indicator (GECI) (AAV9.Syn.GCaMP6s.WPRE.SV40, Addgene) after 4 DIV ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid used for calcium imaging CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid #46021 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and env-expressing plasmids (pMD2.G and psPAX) using the calcium-phosphate method.30 pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: AAV5.CaMKII.GCaMP6f.WPRE.SV40 was the adeno-associated virus (AAV) used for calcium imaging and was obtained from Addgene at 2.3e13 GC-ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Syn-driven GCaMP6f as a calcium sensor was delivered to neurons via AAV9 viral vector transfection (Addgene, pAAV.Syn.GCaMP6f.WPRE.SV40 ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNA binding sequence (AAGAGGTACGTACAGGTACT) was inserted into the vector pDD162 (from Addgene) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... and mitochondrial (CMV-mito-CAR-GECO1) targeted calcium biosensors were gifts from Robert Campbell (Addgene #61244, and #46022) 44 ...
-
bioRxiv - Cell Biology 2020Quote: ... and nuclear (CMV-NLS-R-GECO) targeted calcium biosensors were gifts from Robert Campbell (Addgene #61244, and 32462) [40,41] ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −5.8 mm) with an adeno-associated viral vector conveying the genetically encoded calcium sensor jGCaMP7s (#104491, Addgene) into the SCN and a gradient index lens 0.50 mm in diameter (1050-004611 Inscopix ...
-
bioRxiv - Immunology 2019Quote: ... Lentivirus was generated by calcium phosphate transient transfection of 293T cells using psPAX2 packaging (Addgene, Cambridge, MA, USA) and pMD2.G (Addgene ...