Labshake search
Citations for Addgene :
1 - 50 of 771 citations for RNA Binding Motif Protein 45 RBM45 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid EDEN15 (Addgene plasmid # 107252 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253 ...
-
bioRxiv - Microbiology 2022Quote: The RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253 ...
-
bioRxiv - Molecular Biology 2022Quote: sgRNAs targeting selected MYC binding motifs (E-boxes) were designed using transCRISPR and cloned into lentiCRISPR_v2 vector (Addgene #5296126) (Table 2) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid EDEN15 (Addgene plasmid # 107252; http://n2t.net/addgene:107252; RRID:Addgene_107252) were gifted by Paul Khavari ...
-
bioRxiv - Biochemistry 2021Quote: ... or control peptides with the binding motifs mutated were fused to C terminus of EGFP and cloned to pLJM1-EGFP vector (David Sabatini lab, Addgene plasmid #19319).
-
bioRxiv - Microbiology 2021Quote: ... RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253; http://n2t.net/addgene:107253; RRID:Addgene_107253)] ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Microbiology 2022Quote: The RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253; http://n2t.net/addgene:107253; RRID: Addgene_107253)] and the BASU RaPID plasmid (Addgene plasmid # 107250 ...
-
bioRxiv - Genomics 2021Quote: ... Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). PUF9R-tethered iRFP670 and mRuby2 were created by a combination of PCR (from IDT gBlocks ...
-
bioRxiv - Genomics 2024Quote: Clover fused with PUF RNA-binding domain were previously described: pAC1447 (Clover_PUFc) (Addgene #73689). Cloning of dCas9 expression plasmid (lenti-dCas9-Blast ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Systems Biology 2022Quote: ... Single guide RNAs (sgRNAs) were provided either as gBlocks (IDT technologies)45 with a Cas9 plasmid (Addgene: 62988) or directly as a ribonucleoprotein complex (Cas9 Nuclease ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Biochemistry 2022Quote: ... All expression constructs were in the form containing an N-terminal His6 and maltose-binding protein (MBP) tag (Addgene #11517).
-
bioRxiv - Cell Biology 2023Quote: ... polyspora Hop1319-529 into UC Berkeley Macrolab vectors to generate N-terminal TEV protease-cleavable His6- or His6-maltose binding protein tags (Addgene #29666, 29706). DNA binding mutants of S ...
-
bioRxiv - Neuroscience 2021Quote: ... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
bioRxiv - Biophysics 2020Quote: RNAP core enzyme was expressed from plasmid pIA900 (Addgene #104401; 45) the expression and purification was performed as outlined by Svetlov and Artsimovitch 45 with an additional size exclusion chromatography step performed using a Superose6 10/300 GL column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FOP flash (mutated TCF binding sites; Addgene#12457) luciferase expression vectors and with Renilla luciferase vector (control ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the linearized plasmid pST1374-NLS-flag-linker-Cas9 (Addgene 44758 45) as a template ...
-
bioRxiv - Cell Biology 2023Quote: ... or MRE plasmid with mutated TCF binding sites (Addgene, 12457), together with 100 ng of the Renilla luciferase control plasmid (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... and corresponding DNA oligos were ligated into pCRISPR-Lenti-v2 (Addgene #52961 (45)) as described ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2021Quote: Lentivirus was generated in 293T cells using delta 8.9[45] and pHCMV-EcoEnv (Addgene 15802)[46] as packaging plasmids and 25kDa linear PEI as a transfection agent ...
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (WT p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with either TOP flash (containing TCF binding sites; Addgene#12456) or FOP flash (mutated TCF binding sites ...
-
bioRxiv - Neuroscience 2022Quote: ... The gRNA binding sequence (AAGAGGTACGTACAGGTACT) was inserted into the vector pDD162 (from Addgene) using the NEB Q5 Site-Directed Mutagenesis Kit ...
-
bioRxiv - Bioengineering 2023Quote: ... Wells were transfected with 45 ng PPRE luciferase (a gift from Bruce Spiegelman; Addgene plasmid #1015) and 5 ng renilla control reporter vector (Promega) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all TF binding site and mKate sequences were derived from SPECS plasmids (Addgene #127842). The NFAT response element was subcloned from the pSIRV-NFAT-eGFP plasmid68 (a gift from Peter Steinberger ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reporter constructs contained 14 UAS sites for Gal4-DBD binding (source: Addgene 128010), an enhancer and a core promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... cerevisiae eIF6A was purified essentially as described before (45) from the p7XC3GH (Addgene #47066; Watertown, MA, USA) plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... Ub-M–GFP (#11938) and Ub-R–GFP (#11939) plasmids described in [45] were purchased from Addgene. HA tagged USP5 (#22590 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type I-F Vibrio cholerae HE-45 CAST was sub-cloned from Addgene (#130637 and #130633) [14] ...
-
bioRxiv - Immunology 2023Quote: ... pTwist-SARS-CoV-2D18 B.1.1.529 (Omicron) was a gift from Alejandro Balazs (Addgene plasmid #179907; http://n2t.net/addgene: 179907; RRID:Addgene_179907 (45); pcDNA3.3_SARS2_omicron BA.1 (Addgene plasmid #180375 ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL1R1 sgRNA was custom designed against IL1R1 promoter G-quadruplex (G4-motif B) and cloned in pX333 (Addgene 64073) backbone after replacing Cas9 with mCherry.
-
bioRxiv - Cell Biology 2020Quote: ... PG13-luc (wt p53 binding sites) was a gift from Bert Vogelstein (Addgene plasmid # 16442). The DNA polymerase used was Phusion High Fidelity (cat# E0553S ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477; http://n2t.net/addgene:17477; RRID:Addgene_17477) and pLL-EF1a-rFLuc-T2A-GFP-mPGK-Puro (LL410PA-1 ...
-
bioRxiv - Immunology 2023Quote: ... CHD4 KO cells was similarly transfected with piggy bac plasmid encoding dCas9-KRAB-MeCP2 (45) (Addgene plasmid #110821) and selected with 10 µg/ml blasticidin for 1week then infected with lentiviruses expressing different guide RNAs under U6 promoter.
-
bioRxiv - Genomics 2019Quote: ... A guide RNA sequence with a suitable protospacer adjacent motif (PAM) was found nearby the excision site (Figure 1A, Table S1) and cloned into gRNA_Cloning Vector (Addgene 41824)17 ...
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The CRISPR line robo1ΔWIRS was generated by cloning a guide targeting the WIRS motif into a pCFD3-dU6:3 backbone (Addgene, #49410) and sending positive clones to BestGene Inc ...
-
bioRxiv - Biochemistry 2021Quote: URA7 and URA8 wild type genes with ribosomal binding site were cloned into pet28b-6His (Addgene, Massachusetts ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV9 CaMKII-eGFP (3.45×10^12 virus molecules/mL)(Penn) or AAV5-hDlx-ChR2-mCherry (7.6 ×10^14 virus molecules/mL) (Addgene plasmid # 83898 ...