Labshake search
Citations for Addgene :
1 - 50 of 689 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... and UBC9 (SUMO-E2) constructs were obtained from Addgene. Chk2-FHA plasmid was a gift from Ashok Venkitaraman (MRC) ...
-
bioRxiv - Biochemistry 2021Quote: ... grown in a 100 mm plate format were co-transfected with 4.5 μg psPAX2 (Didier Trono lab, Addgene plasmid #12260), 500 ng pMD2.G (Didier Trono lab ...
-
bioRxiv - Genomics 2024Quote: CROPseq-multi entry vectors with Puromycin (Addgene ID 216217), Zeocin (Addgene ID 216218) ...
-
bioRxiv - Physiology 2023Quote: ... was replaced by the EF-1α promoter from the plasmid pEF.myc.ER-E2-Crimson (Gift from Dr Benjamin Glick; Addgene plasmid # 38770 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Most of the plasmids used in Supplementary Figure 3a were previously deposited in Addgene (AcrIIC3, Addgene #85713; AcrIIC4, Addgene #113434; Acr-E2, Addgene #85677). To clone the plasmid expressing AcrIIA4 ...
-
bioRxiv - Neuroscience 2020Quote: ... And then the multi-sgRNAs were cloned into the AAV vector (Addgene #60231) for virus package ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Microbiology 2023Quote: A549-AT cells were seeded in a 96-well format and were transfected with 0.1 ng of pRL-SV40 (Addgene; #27163) together with either 0.1 μg M50 Super 8x TOPFlash (Addgene ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... which was constructed by integrating a multi-cloning site and the pBAD-I-SceI (Addgene) endonuclease gene into pML104 (Table S4) ...
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).
-
bioRxiv - Molecular Biology 2022Quote: ... Most of the plasmids used in Supplementary Figure 3a were previously deposited in Addgene (AcrIIC3, Addgene #85713; AcrIIC4, Addgene #113434; Acr-E2, Addgene #85677). To clone the plasmid expressing AcrIIA4 ...
-
bioRxiv - Molecular Biology 2023Quote: dCas9-VPR and Cas9 experiments were performed using a published multiplex four sgRNA construct system.79 The four sgRNAs for each of the sgRNA target sites (Kcnk9 TSS, E1, and E2) were cloned into four sgRNA backbones each containing different small RNA promoters (Addgene #53186, #53187, #53188, #53189). Golden Gate cloning into pLV-GG-hUbC-dsRED (Addgene #84034 ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Neuroscience 2020Quote: The epha4b cryptic transcript was amplified from cDNA and inserted into the multi-cloning site of plasmid pCS2+ (Addgene). The in-vitro transcription reaction was performed on linearized plasmid using the mMessage mMachine SP6 Transcription Kit (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Cell Biology 2022Quote: ... Multiple guide RNAs targeting a gene were cloned into the Lenti-multi-Guide plasmid (a gift from Qin Yan; Addgene plasmid #85401) and delivered to iCas9-expressing THP-1 cells by the lentiviral system ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Immunology 2019Quote: ... pCMV-DR8.2 (5 ng, Addgene #12263) and 2.5 μg of the lentiviral vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Neuroscience 2021Quote: ... or KH1*KH2* mutants were PCR amplified from their respective pAc5.1B-EGFP vector and cloned into the HindIII and EcoRI sites of the pAc5.1-lambdaN-HA vector (a gift from Elisa Izaurralde; Addgene plasmid #21302) (Behm-Ansmant et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... was PCR amplified and cloned downstream of EGFP in the pAc5.1B-EGFP vector (a gift from Elisa Izaurralde; Addgene plasmid #21181) using the HindIII and EcoRI restriction sites to make pAcB5.1-EGFP-FMRP ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964). AAV2/9 ...